We narrowed to 7,988 results for: 104
-
Plasmid#72347PurposeMammalian expression of cytoplasmic mMBP TEV cleavage site-linked fusion proteins with C-terminal 6His-tag/Strep-tag II/HA-tagDepositorTypeEmpty backboneTags6His-tag, HA-tag, Strep-tag II, and mMBP with C-t…ExpressionMammalianPromoterCMV enhancer + chicken beta-actin promoterAvailable SinceFeb. 17, 2016AvailabilityAcademic Institutions and Nonprofits only
-
-
pRSF-G1TFAKRS
Plasmid#177311PurposetRNA synthetase/tRNA pair for the in vivo incorporation of N6-(trifluoroacetyl)-L-lysine (TFA-Lys) into proteins in E. coli in response to the amber (TAG) codonDepositorInserttRNA synthetase
ExpressionBacterialPromoterT7Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti-AsCpf1-Blast
Plasmid#84750PurposeExpresses human codon-optimized AsCpf1 protein and blasticidin resistance from EFS promoter. Lentiviral backbone.DepositorInsertAsCpf1
UseCRISPR and LentiviralTagsNLS-3xHA (C terminal on insert)ExpressionMammalianPromoterEFS-NSAvailable SinceDec. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
lenti-EGFR-L858R-tmpknot-epegRNA
Plasmid#214092PurposeLentiviral vector expressing epegRNA to induce EGFR L858R mutationDepositorInsertEGFR L858R epegRNA
UseLentiviralExpressionMammalianPromoterhU6Available SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-HDAC6.ΔBuz-FLAG
Plasmid#30484DepositorInsertHDAC6 (HDAC6 Human)
TagsFLAGExpressionMammalianMutationDeletion of the C-terminal Ubiquitin binding doma…Available SinceSept. 6, 2011AvailabilityAcademic Institutions and Nonprofits only -
dTAG NLRP1
Plasmid#166825PurposedTAG (degron tag) NLRP1 for ligand-controlled N-terminal degradationDepositorAvailable SinceMarch 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUTKan-3xHA-GFP-TOM5
Plasmid#130674PurposeUbiquitously expresses 3xHA-GFP-TOM5 in the outer mitochondrial membrane of plantaDepositorInsertTranslocase of outer mitochondrial membrane 5 (TOM5 Mustard Weed)
Tags3xHA and sGFPExpressionPlantPromoterUbiquitin10Available SinceSept. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHLmMBP-11
Plasmid#72349PurposeMammalian expression of secreted mMBP TEV cleavage site-linked fusion proteins with C-terminal 6His-tag/Strep-tag II/HA-tagDepositorTypeEmpty backboneTags6His-tag, HA-tag, Strep-tag II, and mMBP with C-t…ExpressionMammalianPromoterCMV enhancer + chicken beta-actin promoterAvailable SinceFeb. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
CoxVIIIx2-OeNL(Ca2+)_18μ-pcDNA3
Plasmid#111924PurposeOrange color luminescent indicator for calcium signaling.Mitochondrial targeting signals of subunit VIII of human cytochrome c oxidase (CoxVIII) were fused at the N-terminus of OeNL(Ca2+)_18μDepositorInsertOeNL(Ca2+)_18μ
TagsCoxVIIIx2ExpressionMammalianMutationE67D, E104D, D133E at CaMPromoterCMVAvailable SinceJune 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR221 NLRP1
Plasmid#166823PurposeGateway pDONR vector containing NLRP1 (no stop codon)DepositorInsertNLRP1 (NLRP1 Human)
UseGateway shuttling vectorAvailable SinceMarch 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
Carl-CeNL(Ca2+)_110μ-KDEL-pcDNA3
Plasmid#111925PurposeCyan color luminescent Ca2+ indicator targeted to endoplasmic reticulum. Calreticulin and a KDEL signal for ER retention located at the N-terminus and C-terminus of CeNL(Ca2+)_110μDepositorInsertCeNL(Ca2+)_110μ
TagsCalreticulin and KDELExpressionMammalianMutationE31D, F92W, E104D. D133E at CaMPromoterCMVAvailable SinceJune 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHLmMBP-3
Plasmid#72345PurposeMammalian expression of secreted N-terminally 8His-tagged mMBP-fused proteins with C-terminal 6His-tag/Strep-tag II/HA-tagDepositorTypeEmpty backboneTags6His-tag, 8His-tag, HA-tag, Strep-tag II, and mMB…ExpressionMammalianPromoterCMV enhancer + chicken beta-actin promoterAvailable SinceFeb. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
hDAGLa-V5
Plasmid#87676PurposeExpresses human DAGL? protein with intracellular V5 tag located on the C-terminalDepositorAvailable SinceMarch 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti-LbCpf1-Blast
Plasmid#84751PurposeExpresses human codon-optimized LbCpf1 protein and blasticidin resistance from EFS promoter. Lentiviral backbone.DepositorInsertLbCpf1
UseCRISPR and LentiviralTagsNLS-3xHA (C terminal on insert)ExpressionMammalianPromoterEFS-NSAvailable SinceDec. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-IRES-puro-NLS-dRanCas13b-EGFP-NLS-3xFlag
Plasmid#132409Purposeoverexpression in human cellsDepositorInsertdRanCas13b
UseLentiviralTagsflagExpressionMammalianMutationH147A; H1044AAvailable SinceJan. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
CoxVIIIx2-CeNL(Ca2+)_19μ-pcDNA3
Plasmid#111923PurposeCyan color luminescent indicator for calcium signaling.Mitochondrial targeting signals of subunit VIII of human cytochrome c oxidase (CoxVIII) were fused at the N-terminus of CeNL(Ca2+)_19μDepositorInsertCeNL(Ca2+)_19μ
TagsCoxVIIIx2ExpressionMammalianMutationE67D, F92W, E104D, D133E at CaMPromoterCMVAvailable SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
lenti-KRAS-G12C-tmpknot-epegRNA
Plasmid#214094PurposeLentiviral vector expressing epegRNA to induce KRAS G12C mutationDepositorInsertKRAS G12C epegRNA
UseLentiviralExpressionMammalianPromoterhU6Available SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTR-N90-beta-catenin
Plasmid#31787DepositorInsertbeta-catenin (CTNNB1 Human)
UseEntry vectorTagsMycMutationDeletion of aa 1-90- Constitutively ActiveAvailable SinceOct. 21, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEGFP.N1-HDAC6.delta Buz
Plasmid#36190DepositorInsertHDAC6..delta Buz (HDAC6 Human)
TagsEGFPExpressionMammalianMutationDeletion of the C-terminal ub binding domain (BUZ…PromoterCMVAvailable SinceApril 19, 2012AvailabilityAcademic Institutions and Nonprofits only -
pET21 Catalytic Domain of MALT1
Plasmid#48970PurposeExpresses catalytic domain of MALT1 in e.coli AA 329-566DepositorAvailable SinceOct. 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
GST-Delta23C11orf83
Plasmid#65849Purposebacterial expression of GST (N-ter) - Delta 23 C11orf83/UQCC3 (UQCC3 protein depleted of its N-terminal transmembrane domain)DepositorInsertUQCC3 depleted of its N terminal transmembrane part (UQCC3 Human)
TagsGSTExpressionBacterialMutationdeletion of the 23 first aa (TM)Available SinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pH2R-mCherry-N1
Plasmid#84326PurposeHistamine-2 receptor tagged with mCherryDepositorAvailable SinceDec. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Lyso-mCherry-Rheb(C181S)
Plasmid#192438PurposeEncodes mCherry-tagged, farnesylation-deficient Rheb C181S mutant targeted to lysosome membrane.DepositorInsertLyso-mCherry-Rheb(C181S) (RHEB Human)
TagsFull-length LAMP1 and mCherryExpressionMammalianMutationRheb Cys 181 mutated to Ser; abolishes C-terminal…PromoterCMVAvailable SinceDec. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-mCherry-Rheb(C181S)
Plasmid#192437PurposeEncodes mCherry-tagged, farnesylation-deficient Rheb C181S mutant.DepositorInsertmCherry-Rheb(C181S) (RHEB Human)
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianMutationRheb Cys 181 mutated to Ser; abolishes C-terminal…PromoterCMVAvailable SinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
lenti-KRAS-G13A-tmpknot-epegRNA
Plasmid#214095PurposeLentiviral vector expressing epegRNA to induce KRAS G13A mutationDepositorInsertKRAS G13A epegRNA
UseLentiviralExpressionMammalianPromoterhU6Available SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPong_v2
Plasmid#47101PurposeExpresses the Pong ORF1 and transposase from rice to allow mPing movement. Contains ORF1 and transposase driven by a native soybean promoter. Contains mPing and BAR for basta selection.DepositorInsertsmPing
Pong Open Reading Frame 1 (ORF1)
Pong Transposase
UsePlant expressionPromoterGmUbi_AP, GmUbi_XS, and no promoterAvailable SinceOct. 29, 2013AvailabilityIndustry, Academic Institutions, and Nonprofits -
Rec-PhoA/CsgA
Plasmid#170787PurposeRecombinase controlled expression of csgA and phoA. Expression is activated upon flipping of inverted proD with corresponding recombinaseDepositorUseSynthetic BiologyTagsHHHHHHExpressionBacterialPromoterInverted proD with Bxb1recognition sites and Inve…Available SinceSept. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHLmMBP-2
Plasmid#72344PurposeMammalian expression of secreted N-terminally 6His-tagged mMBP-fused proteins with C-terminal 6His-tag/Strep-tag II/HA-tagDepositorTypeEmpty backboneTags6His-tag, HA-tag, Strep-tag II, and mMBPExpressionMammalianPromoterCMV enhancer + chicken beta-actin promoterAvailable SinceFeb. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
L309-myc-seipin-WT
Plasmid#64061Purposemyc-tagged murine seipin (wild type); lentiviral constructDepositorAvailable SinceJuly 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDule2-IBBN (G2)
Plasmid#85501PurposePlasmid for incorporating the non-canonical amino acid IBBN with the Mj IBBN (G2) synthetase and cognate amber suppressing tRNA in Ecoli.DepositorInsertIBBN (G2) synthetase and cognate amber suppressing tRNA derived from M. jannaschii Tyrosine synthetase/tRNA system
ExpressionBacterialMutationY32G L65E F108W Q109M D158S R162KPromoterlpp (constitutive)Available SinceMarch 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
Sa-dCas9-NLS-3xFLAG/pcDNA3.1
Plasmid#98041PurposeExpresses Sa-dCas9-NLS-3xFLAG in mammalian cells for enChIP analysis to purify specific genomic regions of interestDepositorInsertSa-dCas9-NLS-3xFLAG
UseCRISPRTags3xFLAG tag and NLS (nuclear localization signal)ExpressionMammalianMutationD10A + H557APromoterCMVAvailable SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pcDNA3.1(+) Laccase2 MCS-ciRS7 Exon
Plasmid#69900PurposeExpresses the human ciRS7/CDR1as circular RNA in mammalian cellsDepositorAvailable SinceOct. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRc/CMV-Beta(4)Integrin
Plasmid#16265DepositorInsertBeta 4 Integrin (ITGB4 Human)
ExpressionMammalianMutationlacked the 70- and 7-amino acid splice variants a…Available SinceMarch 6, 2008AvailabilityAcademic Institutions and Nonprofits only -
lenti-EGFR-T790M-tmpknot-epegRNA
Plasmid#214093PurposeLentiviral vector expressing epegRNA to induce EGFR T790M mutationDepositorInsertEGFR T790M epegRNA
UseLentiviralExpressionMammalianPromoterhU6Available SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDule-IBBN (G2)
Plasmid#85500PurposePlasmid for incorporating the non-canonical amino acid IBBN with the Mj IBBN (G2) synthetase and cognate amber suppressing tRNA in Ecoli.DepositorInsertIBBN (G2) synthetase and cognate amber suppressing tRNA derived from M. jannaschii Tyrosine synthetase/tRNA system
ExpressionBacterialMutationY32G L65E F108W Q109M D158S R162KPromoterlpp (constitutive)Available SinceMarch 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
lenti-GBA-N370S-tmpknot-epegRNA
Plasmid#214091PurposeLentiviral vector expressing epegRNA to induce GBA N370S mutationDepositorInsertGBA N370S epegRNA
UseLentiviralExpressionMammalianPromoterhU6Available SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Beta(4)Integrin-DeltaCYT
Plasmid#16264DepositorInsertBeta 4 Integrin (ITGB4 Human)
ExpressionMammalianMutationtruncated cytoplasmic tail introduced a stop cod…Available SinceMarch 6, 2008AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-Zeo-TTF-1
Plasmid#75089Purposeretrovirus-mediated gene transfer into mammalian cellsDepositorInsertTTF-1 (NKX2-1 Human)
UseRetroviralTagsnoneExpressionMammalianMutationwild-type, full-length, without native 3' UTRAvailable SinceMay 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-Tmx4-V5
Plasmid#120236PurposeExpresses V5-tagged Tmx4 in lentiviral vectorDepositorAvailable SinceJan. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Dest47- WTN23C11orf83-GFP
Plasmid#65845PurposeMammalian expression of the wild type N terminal part (N23, transmembrane part of 23 aa) of C11orf83/UQCC3 fused to GFP protein (C-ter)DepositorInsertTransmembrane (23 AA) of UQCC3 (UQCC3 Human)
TagsGFPExpressionMammalianMutationWT TransmembraneAvailable SinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
HEpl017
Plasmid#179992PurposepCBh_NLS_TadA8e_dSiCas12i_NLS_pA_pCMV_mCherry_pU6_crRNA_BbsI: vector for encoding a human codon-optimized dSiCas12i-ABE8e driven by CBh promoter and tagmCherry driven by CMV promoterDepositorInsertTadA8e-dSiCas12i(D1049A)
ExpressionMammalianAvailable SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-mCherry-TSC2(AA)
Plasmid#192442PurposeEncodes mCherry-tagged TSC2 isoform 5 with S939A, T1439A mutations to block Akt phosphorylation.DepositorInsertmCherry-TSC2(S939A,T1439A) (TSC2 Human)
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianMutationTSC2 Ser 939 and Thr 1439 (equivalent to 1462 in …PromoterCMVAvailable SinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAG8H-EWS_1-264
Plasmid#180467PurposeExpresses the construct His8-EWS_1-264 with a TEV cleavage site for the removal of the His8 tagDepositorAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSW554 - pOp5:SP-mVenus-HDEL
Plasmid#116006Purposedestination vector for GreenGate cloning method, contains 2x a set of modules from A-F, "Driver line", tissues-specific promoter, Dex-inducible mTurquoise2 expressionDepositorInsertpOp5:SP(ER)-mVenus-HDEL:tUBQ10::SulfR
TagsHDEL and SP(ER)ExpressionPlantAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR221 NLRP1 S1213A
Plasmid#166824PurposeGateway pDONR vector containing NLRP1 with the P1214R patient mutation (no stop codon)DepositorAvailable SinceMarch 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBacPAK8-His-myc-Rbx1
Plasmid#29506DepositorAvailable SinceApril 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti_dCas9-2xAM_hIRF-1
Plasmid#92221PurposeLentiviral plasmid expressing dCas9-2xAM and gRNA for human IRF-1 promoterDepositorInsertsSp-dCas9-2xAM tag
gRNA targeting human IRF-1 promoter
UseCRISPR and LentiviralTags2xAM tagExpressionMammalianMutationhuman codon-optimized, D10A + H840APromoterCBh and U6Available SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only