175,586 results
-
Plasmid#172718PurposeExpression of a fast folding GFP variant GFP plusDepositorInsertGFP plus
ExpressionBacterialAvailable SinceSept. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pC1-HyPerRed-mito
Plasmid#60247PurposeMitochondria-targeted genetically encoded hydrogen peroxide indicator with red fluorescence.DepositorInsertHyPerRed-mito
TagsMitochondrial targeting signalExpressionMammalianPromoterCMVAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuet-sumo-NSP12 (SARS-CoV-2)
Plasmid#159107PurposeThe SARS-CoV-2 NSP12 coding sequence was cloned into a modified pRSFDuet-1 vector (Novagen) bearing an N-terminal His6-SUMO-tag which is cleavable by the ubiquitin-like protease (ULP1).DepositorInsertNSP12
TagsHis-SUMO tagExpressionBacterialMutationNonePromoterT7Available SinceSept. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
C1-F-tractin-mCherry
Plasmid#155218PurposeMonitor global F-actin distributionDepositorInsertF-tractin (aa 9-52 of rat ITPKA) fused to mCherry (Itpka Rat)
TagsmCherryExpressionMammalianAvailable SinceSept. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPP085
Plasmid#158795PurposepRSF-Duet1 derived plasmid containing C-terminally hexa-histidine tagged CasΦ-2 in MCS1 for expression in E. coli and protein purificationDepositorInsertCasPhi-2
Tags6xHisExpressionBacterialAvailable SinceAug. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCX-SpiCee
Plasmid#140836Purposemammalian expression of SpiCee, a buffer of calcium that prevents downstream signalingDepositorInsertSpiCee
TagsmRFPExpressionMammalianPromoterCAGAvailable SinceJuly 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 SARS-CoV-2 NSP9
Plasmid#141263PurposeGateway-compatible Entry vector, with insert of NSP9 gene's CDS from SARS-CoV-2 isolate Wuhan-Hu-1DepositorInsertNSP9 (ORF1ab SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway CloningMutationMany synonymous changes due to codon optimizationAvailable SinceApril 1, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCRISPR-HOT_tdTomato
Plasmid#138567PurposeUniversal Cleavable Donor Plasmid for tagging with tdTomato using NHEJDepositorInserttdTomato
UseUnspecifiedAvailable SinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-HOT-P2A-Clover-BlastR
Plasmid#138568PurposeUniversal Cleavable Donor Plasmid for tagging with P2A-Clover-BlastR using NHEJDepositorInsertP2A-clover-BlastR
UseCRISPRAvailable SinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCC_05 - hU6-BsmBI-sgRNA(E+F)-barcode-EFS-dCas9-NLS-VPR-2A-Puro-WPRE
Plasmid#139090PurposeExpresses human codon-optimized inactive SpCas9 fused to a transcriptional activator VPR in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a barcode downstream of sgRNA cassette.DepositorInsertdSpCas9-VPR
UseCRISPR and LentiviralExpressionMammalianMutationD10A, H840AAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDH-cGAS-E225A D227A-mCherry2-EF1-Puro
Plasmid#132771PurposeInteracts with cytoplasmic DNA. Useful for identifying sites of nuclear envelope rupture.DepositorInsertCyclic GMP-AMP synthase (CGAS Human)
UseLentiviralTagsmCherry2ExpressionMammalianMutationE225A D227AAvailable SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-2E2-HA-mEGFP
Plasmid#129595PurposeThe encoded protein is the anti-HA frankenbody variant fused with the mEGFP. It can be used to track mature and nascent HA tagged proteins in living organism.DepositorInsertAnti-HA frankenbody variant-mEGFP (2E2-HA scFv-mEGFP)
ExpressionMammalianPromoterCMVAvailable SinceAug. 15, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pQE30-His-PheRS
Plasmid#124116PurposeBacterial expression plasmid for PURE system componentsDepositorAvailable SinceJune 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET21a-SerRS-His
Plasmid#124118PurposeBacterial expression plasmid for PURE system componentsDepositorAvailable SinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET21a-LysRS-His
Plasmid#124114PurposeBacterial expression plasmid for PURE system componentsDepositorAvailable SinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-KRAS
Plasmid#116755PurposeLentiviral expression of KRASDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
ARHGEF11(DHPH)-CRY2-mCherry
Plasmid#89481PurposeAlso known as optoGEF-RhoA, encodes for a fusion between CRY2(1-498)-mCherry and the DHPH domain of ARHGEF11DepositorTagsmCherryExpressionMammalianPromoterCMVAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-H2B tdTomato
Plasmid#116870PurposeNuclear localized tdTomatoDepositorHas ServiceAAV RetrogradeInsertH2B tdTomato
UseAAVAvailable SinceNov. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-hA3A-BE3
Plasmid#113410PurposeExpresses hA3A-BE3 in mammalian cellsDepositorInserthA3A-BE3 (APOBEC3A S. pyogenes and Bacteriophage PBS2, Human)
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceOct. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.3 LRP5
Plasmid#115907PurposeExpresses human LRP5 in mammalian cells.DepositorAvailable SinceOct. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
ErkKTR-irFP
Plasmid#111510PurposeReporter of Erk activityDepositorAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EWB-DIO-cyan pre-eGRASP(p32)
Plasmid#111589PurposeAn AAV vector that expresses double floxed cyan pre-eGRASP(p32) under the Ef1a promoter.DepositorInsertcyan pre-eGRASP(p32)
UseAAVPromoterEf1aAvailable SinceJune 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
sgCtr- LentiCRISPRv2
Plasmid#107402PurposeLentiviral expression of Cas9 and a control gRNADepositorInsertcontrol gRNA
UseLentiviralAvailable SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
EGFP-RILP
Plasmid#110498PurposeFluorescent RILPDepositorAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTol2-hsp70l:Cas9-t2A-GFP, 5xU6:sgRNA
Plasmid#108871PurposeExpression of heat shock inducible Cas9-GFP and U6-driven 5 individual gRNAs for scGESTALT in zebrafishDepositorInserts5xU6:sgRNA
Cas9-t2A-GFP
UseCRISPRPromoterU6 and hsp70Available SinceApril 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
p46Cpf1-OP2
Plasmid#98592PurposeProduces lambda Red and Cpf1 for recombination and selection. The plasmid is combined with a donor plasmid (with crRNA and template) for rapid genome editing in E.coli.DepositorInsertFnCpf1
UseCRISPRExpressionBacterialMutationCodon optimized for E. coliPromoteraraBADAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENN.AAV.CMVs.Pl.Cre.rBG
Plasmid#105537PurposeAAV expression of Cre from CMV promoterDepositorHas ServiceAAV rh10, AAV1, AAV2, AAV5, AAV8, and AAV9InsertCre
UseAAV and Cre/LoxExpressionMammalianPromoterCMVAvailable SinceFeb. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.eGFP.WPRE.hGH
Plasmid#105549PurposeAAV expression of EGFP from GFAP promoterDepositorHas ServiceAAV5InserteGFP
UseAAVExpressionMammalianPromoterGFAPAvailable SinceFeb. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSAD-F3-NPEST-iCRE-2A-mCherryPEST
Plasmid#99608PurposeSelf-inactivating DG-Rabies (SiR) expressing iCRE and destabilised mCherryDepositorInsertsiCRE
mCherry
UseUnspecifiedTagsPESTAvailable SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCI-neo FlucSM EGFP
Plasmid#90171PurposeEGFP-tagged constructs to monitor the aggregation state of the sensors and the ability of cells to solubilize or degrade the aggregated proteins. FLuc contains single mutationDepositorInsertFLuc EGFP
ExpressionMammalianMutationR188Q in FLucAvailable SinceAug. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEN84 - CTCF-AID[71-114]-eGFP-FRT-Puro-FRT targeting construct
Plasmid#86230PurposeTargeting vector to introduce an AID-eGFP cassette at the mouse CTCF locus using puromycine selection. Auxin-inducible degron system.DepositorInsertAID[71-114]-eGFP
UseMouse TargetingExpressionMammalianAvailable SinceMay 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_SPOP_WT
Plasmid#81856PurposeGateway Donor vector containing SPOP ,part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_KRAS_p.G12D
Plasmid#81651PurposeGateway Donor vector containing KRAS, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pT7-VP3SA11
Plasmid#89164PurposeExpress Rotavirus SA11 VP3 in mammalian cellsDepositorInsertRotavirus SA11 VP3
ExpressionMammalianPromoterT7 promotorAvailable SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDonor-tBFP-NLS-Neo (Universal)
Plasmid#80767PurposeUniversal donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.DepositorInsertPITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pACYC-Skp-GroEL/ES
Plasmid#83922PurposeCo-expresses cytoplasmic copies of the Skp and Gro EL/ES protein folding chaperones.DepositorInsertsSkp
Gro EL/ES
ExpressionBacterialPromoterT7Available SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-TagGFP2-PuroR
Plasmid#80970PurposeCRISPaint gene taggingDepositorInsertTagGFP2
UseGene taggingPromoternoneAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pIκBα-miRFP703
Plasmid#80005PurposeIκBα fused with near-infrared fluorescent protein miRFP703 (IκBα reporter)DepositorAvailable SinceJuly 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_erGAP3
Plasmid#78118PurposeLow affinity fluorescent calcium indicator of the GAP (GFP-Aequorin Protein) family targeted to the endoplasmic reticulumDepositorInserterGAP3
TagsKDEL and calreticulin signal peptideExpressionMammalianMutationS175G, D180Y, I167V and L15Q in GFP moiety and D…PromoterCMVAvailable SinceJuly 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEGFP_TRPM8
Plasmid#64879PurposeExpresses Ion Channel TRPM8 fused to eGFP in mammalian cellsDepositorInsertTransient receptor potential cation channel subfamily M member 8 (Trpm8 Rat)
TagseGFPAvailable SinceJune 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
p323-L10A-PATagRFP
Plasmid#74172PurposeFluorescent reporter for single ribosome trackingDepositorAvailable SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEvol-pAcFRS.2.t1
Plasmid#73544PurposetRNA synthetase/tRNA pair for the in vivo incorporation of several non-standard amino acids, into proteins in E coli in response to the amber codon, TAGDepositorInsertspAcFRS.2.t1
pAcFRS.2.t1
ExpressionBacterialAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
NLS-mCherry-NES reporter (pDN160)
Plasmid#72660PurposeNLS-mCherry-NES 17 reporter for light-inducible nuclear export block with pDN157 and pDN158DepositorInsertNLS-mCherry-NES
ExpressionMammalianPromoterCMVAvailable SinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET28a SnoopTag-mEGFP-SpyTag
Plasmid#72325PurposeBacterial expression of monomeric enhanced green fluorescent protein (mEGFP) containing SnoopTag at the N-terminus and SpyTag at the C-terminus, for programmed polyprotein synthesis.DepositorInsertpET28a SnoopTag-mEGFP-SpyTag
TagsN-terminal His6 tagExpressionBacterialAvailable SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET28a-MSP1D1deltaH4-H6
Plasmid#71717PurposeMembrane scaffold protein (MSP), helix 4 to 6 deletionDepositorInsertApolipoprotein A1 (APOA1 Human)
ExpressionBacterialAvailable SinceDec. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pST44
Plasmid#64007Purposepolycistronic cloning vector for pST44 plasmid suiteDepositorTypeEmpty backboneExpressionBacterialPromoterT7Available SinceNov. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pT040
Plasmid#67640PurposeURA3 vector for cloning guide sequences using BclI-SwaI sites into guide RNA expression cassetteDepositorInsertsingle guide RNA expression cassette
UseCRISPRExpressionYeastPromoterpSNR52Available SinceAug. 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT-EF-Pdgfrbeta-EGFPN
Plasmid#66790PurposeExpression of murine PDGFRbeta tagged with GFP under the control of EF1a promoterDepositorAvailable SinceAug. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
Str-KDEL_neomycin
Plasmid#65306PurposeLuminal ER hook only (RUSH system)DepositorInsertStreptavidin fused to a signal sequence at 5' end and to a KDEL motif at 3' end
TagsKDEL motif and Signal SequenceExpressionMammalianPromoterCMVAvailable SinceJune 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-SP-Cas9 reporter
Plasmid#62733PurposeMammalian CRISPR-SP-Cas9 reporterDepositorInsertCRISPR-SP-Cas9 target seq + tdTomato (out of frame)
UseCRISPR and LentiviralTagsCRISPR-SP-Cas9 target seq (hAAVS1 locus) and HA t…ExpressionMammalianPromoterEF1-AlphaAvailable SinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only