We narrowed to 4,396 results for: erf
-
Plasmid#58711PurposeCharacteristic fingerprint molecule to perform single molecule force spectroscopy experiments; covalently immobilized via ybbr tagDepositorInsertXyl-DocI
TagsHIS, HRV 3C, and ybbRExpressionBacterialMutationchanged Threonin 120 to Cysteine in Xylanase Doma…PromoterT7Available SinceAug. 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJMP1171
Plasmid#119253Purposerfp "test" strainDepositorInsertdcas9
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28-sfGFP-DogTag Loop B
Plasmid#171780PurposeExpresses in bacterial cytoplasm superfolder GFP with DogTag and flanking linkers between Asp102 and Asp103DepositorInsertsfGFP-DogTag Loop B
TagsHis6ExpressionBacterialMutationDogTag and linkers inserted between residues Asp1…PromoterT7Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDN0606 (pDEST-DHFR F[3] N-term,HygR)
Plasmid#210488PurposepDEST vector to tag gene of interest with DHFR F[3] on the N-terminus to perform DHFR-PCA in S. cerevisiae.DepositorTypeEmpty backboneUseSynthetic Biology; Destination vector for gateway…ExpressionYeastPromoterADH1Available SinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKB11 (pDEST-DHFR F[1,2] C-term, NatR)
Plasmid#210485PurposepDEST vector to tag gene of interest with DHFR F[1,2] on the C-terminus to perform DHFR-PCA in S. cerevisiae.DepositorTypeEmpty backboneUseSynthetic Biology; Destination vector for gateway…ExpressionYeastPromoterADH1Available SinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDN0605 (pDEST-DHFR F[1,2] N-term, NatR)
Plasmid#210487PurposepDEST vector to tag gene of interest with DHFR F[1,2] on the N-terminus to perform DHFR-PCA in S. cerevisiae.DepositorTypeEmpty backboneUseSynthetic Biology; Destination vector for gateway…ExpressionYeastPromoterADH1Available SinceDec. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKB12 (pDEST-DHFR F[3] C-term, HygR)
Plasmid#210486PurposepDEST vector to tag gene of interest with DHFR F[3] on the C-terminus to perform DHFR-PCA in S. cerevisiae.DepositorTypeEmpty backboneUseSynthetic Biology; Destination vector for gateway…ExpressionYeastPromoterADH1Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
NAX_CAGGS_CAS9_m4_KanR neo
Plasmid#167869PurposePiggyBac compatible plasmid expressing dCas9DepositorInsertdCas9
UseCRISPRMutationD10A, D839A, H840A, N863AAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pQTEV-PRKRA
Plasmid#31571DepositorInsertprotein kinase, interferon-inducible double stranded RNA dependent activator (PRKRA Human)
TagsHis and TEVExpressionBacterialAvailable SinceMarch 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pX330-HA-dSpCas9
Plasmid#92112PurposeExpression plasmid for human codon-optimized dead/inactive SpCas9 (without U6-sgRNA coding sequence)DepositorInsertdead/inactive SpCas9
UseCRISPRTagsHA tag and NLSExpressionMammalianMutationD10A, H840APromoterCbhAvailable SinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
dCas9-NLS-gs10-cGR2176
Plasmid#188258PurposePlasmid ensures constitutive expression of the C-terminal fragment of split GR2 (aa 239-267), fused to the catalytically inactive Cas9 (dCas9) protein, a flexible GS linker and the SV40 NLS signal at the N-terminusDepositorInsertcGR2176
UseCRISPRExpressionMammalianAvailable SinceNov. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFLAG GLTP
Plasmid#170740PurposeThe plasmids contain inserts (ORFs) for expressing various members of the GlycoLipid Transfer Protein (GLTP) superfamily.DepositorAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJMP1161
Plasmid#119251Purposerfp "test" strainDepositorInsertdcas9
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28a-Hook3 aa 1-160-GCN4
Plasmid#74608PurposeExpresses artificially dimerized Hook domain of Hook3 in bacteria for purificationDepositorInserthuman Hook3 amino acids 1-160 (HOOK3 Human)
Tags6x His, GCN4, Strep II, and superfolder GFPExpressionBacterialAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
spa-GCaMP6s
Plasmid#67556Purposephotoactivatable fluorescent calcium reporterDepositorInsertspa-GCaMP6s
TagsHIS-tagExpressionMammalianMutationK65T, I83V, G87S, Y92D, V115H, K118V, S187R, Y196…Available SinceJuly 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMOD_A0801
Plasmid#91022PurposeModule A, Promoter: 35S, Gene: Csy4-P2A-AtCas9_dead (D10A + H840A), Terminator: HSPDepositorInsertCsy4-P2A-AtCas9_dead (D10A + H840A)
UseCRISPRMutationD10A, H840APromoter35SAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1
Plasmid#188963PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: atcggtcgcattgttttccactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28-sfGFP[D134TAG+N150TAA]
Plasmid#164582Purposesuperfolder GFP with D134TAG and N150TAA mutationsDepositorInsertsfGFP-134TAG+150TAA
Tags6xHisExpressionBacterialMutationD134TAG + N150TAA MutationsPromoterT7Available SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEN-R2-mCsfGFP-L3
Plasmid#178602PurposeIt can be used to study protein turnover in living plant cells of Arabidopsis (Arabidopsis thaliana) and Nicotiana benthamiana.DepositorInsertTandem fluorescent protein timers (tFTs)
UseEntry vector for gateway cloningTagsmCherry superfolder GFPAvailable SinceDec. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMOD_A1810
Plasmid#91040PurposeModule A, Promoter: ZmUbi, Gene: Csy4-P2A-TaCas9_dead (D10A + H840A), Terminator: HSPDepositorInsertCsy4-P2A-TaCas9_dead (D10A + H840A)
UseCRISPRMutationD10A, H840APromoterZmUbiAvailable SinceJuly 10, 2017AvailabilityAcademic Institutions and Nonprofits only