We narrowed to 12,964 results for: BASE
-
Plasmid#201685PurposeAll-in-one AAV plasmid expressing Nme2-ABE8e-i1 and U6 driven sgRNA targeting the mouse Rosa26 geneDepositorInsertNme2-ABE8e-i1
UseAAV and CRISPRExpressionMammalianPromoterU1aAvailable SinceJan. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEJS2604_AAV-Nme2-ABE8e-i1(V106W)-U6-Rosa26
Plasmid#201686PurposeAll-in-one AAV plasmid expressing Nme2-ABE8e-i1 (V106W) and U6 driven sgRNA targeting the mouse Rosa26 geneDepositorInsertNme2-ABE8e-i1 (V106W)
UseAAV and CRISPRExpressionMammalianPromoterU1aAvailable SinceJan. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
NLS-nCas9-NLS-P2A-EGFP (pRZ70)
Plasmid#123616PurposeCMV promoter expression plasmid for codon-optimized bpNLS-32AA linker-hSpCas9n(D10A)-bpNLS-P2A-EGFP (ABEmax control without TadA domains).DepositorInsertNLS-nCas9-NLS-P2A-EGFP
ExpressionMammalianMutationD10A in SpCas9PromoterCMVAvailable SinceApril 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCIneoLuc-PP2A
Plasmid#128349PurposeVector for LUMIER assayDepositorAvailable SinceSept. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pINDUCER21-puro_TAOK2
Plasmid#172979Purposedoxycycline-inducible expression of TAOK2DepositorAvailable SinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
nLuc_AP10_PPVs_P9mS
Plasmid#119302PurposeExpresses N-terminus of split luciferase fused to antiparallel coiled-coil AP10 connected with autoinhibitory coil P9mS and PPVs cleavage site in antiparallel harpin linker/for SPOC logicDepositorInsertsplit nLuc fused to antiparallel Coiled-coil AP10 connected with P9mS via PPV cleavable linker
UseLuciferaseExpressionMammalianPromoterCMVAvailable SinceFeb. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
SNX25-PX (506-628)
Plasmid#119104PurposeBacterial expression of human phox homology (PX) domain, SNX25-PX (506-628)DepositorAvailable SinceApril 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-moxGFP-Puro-MAPRE1
Plasmid#207794PurposeDonor template to insert moxGFP-2A-Puro into the C-terminus of the MAPRE1 locus for growing microtubule tip visualization. To be co-transfected with sgRNA plasmid px330-PITCh-MAPRE1 Addgene #207793DepositorInsertMAPRE1 Homology Arms flanking a moxGFP-Puro Cassette (MAPRE1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceDec. 1, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA3.1 GW-mCit-PA
Plasmid#113449PurposeProteinA-mCitrine Gateway shuttle vector for C-terminal fusionsDepositorTypeEmpty backboneUseGateway shuttle vectorTagsmCitrine-ProteinAExpressionMammalianPromoterCMVAvailable SinceAug. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-CnVA
Plasmid#24587DepositorInsertGateway(TM) cassette
UseLentiviralTagsVAExpressionMammalianAvailable SinceJuly 14, 2010AvailabilityAcademic Institutions and Nonprofits only -
pET-pro-siRNA-V2-TP53
Plasmid#111089PurposepET-pro-siRNA-V2 based plasmid for production of recombinant siRNAs (pro-siRNAs) against human TP53 gene.DepositorInsertTP53 (TP53 Human)
ExpressionBacterialAvailable SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
KQ403: pMAGIC (R4-R3) NLS-x dCas9(3.7)-NLS-LSD1
Plasmid#121831PurposepMAGIC R4-R3 entry plasmid, contains 2x NLSx-dCas9(3.7) fused to the LSD1 H3K4me1/2 demethylase for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertx-dCas9(3.7)/LSD1 (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLQ2818_Blasti_pPB: CAG-PYL1-KRAB-IRES-Blasti-WPRE-SV40PA PGK-ABI-tagBFP-SpdCas9-FKBP_F36V
Plasmid#187959PurposeExpressed ABA-inducible dimerizing KRAB-dCas9 system, with KRAB-IRES-Blasticidin resistance under CAG promoter and tagBFP-dCas9-FKBP12 (F36V mutant) degron under PGK promoter in a piggyBac plasmid.DepositorInsertsBlasticidin resistance
FKBP12_F36V
UseCRISPR and Synthetic BiologyTagsGGS linkerExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Cplx2-GFP KI
Plasmid#131476PurposeEndogenous tagging of Complexin2: C-terminal (amino acid position: L128)DepositorAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
SNX5-PX (26-170)
Plasmid#119086PurposeBacterial expression of human phox homology (PX) domain, SNX5-PX (26-170)DepositorAvailable SinceApril 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
P9_TEVs_cLuc
Plasmid#119303PurposeExpresses C-terminus of split luciferase connected to P9 coil via TEVs cleavable linker/for split protease-cleavable orthogonal Coiled-coil (SPOC) logicDepositorInsertsplit cLuc connected to P9 coil via TEVs cleavable linker
UseLuciferaseExpressionMammalianPromoterCMVAvailable SinceAug. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-mScarlet-ACTB
Plasmid#207754PurposeDonor template for Puro-2A-mScarlet insertion into the N-terminus of the ACTB locus for actin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-ACTB Addgene #207748DepositorInsertACTB Homology Arms flanking a Puro-mScarlet Cassette (ACTB Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 16, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSW002-Pc-TorT(sp)-mNeonGreen
Plasmid#205021PurposeBroad host-range bacterial expression vector with constitutive Pc promoter. Provides E. coli TorT signal peptide in frame with mNeonGreen (codon optimized for expression in P. fluorescens); for targeting mNeonGreen to the periplasmDepositorInsertTorT-mNeonGreen
ExpressionBacterialMutationmNeonGreen is codon optimized for expression in P…PromoterPcAvailable SinceSept. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
mSNX13-PX (558-677)
Plasmid#119094PurposeBacterial expression of human phox homology (PX) domain, mSNX13-PX (558-677)DepositorInsertmSNX13-PX (558-677)
TagsGSTExpressionBacterialPromotertacAvailable SinceApril 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
SNX14-PX (561-686)
Plasmid#119095PurposeBacterial expression of human phox homology (PX) domain, SNX14-PX (561-686)DepositorAvailable SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUPD2 sgRNAscaffold 2.1 scRNA (GB1437)
Plasmid#160571PurposeVersion of SgRNA scaffold with the sequence 2.1 of Ms2 aptamer in the 3' end.DepositorInsertsgRNAscaffold 2.1 scRNA
UseCRISPRMutationBsaI and BsmBI sites removedAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9_sgRNA NC
Plasmid#176259PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and spacer sequence on sgRNA is replaced by the type IIS restriction site for endonuclease BaeI andDepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseMutationH840A and D10A mutations on spCas9 to inactivate …Available SinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pdCas9 (GB1079)
Plasmid#75399PurposeProvides the human codon optimized CDS of Cas9 protein with mutated (D10A, H840A) and inactivated catalytic domains as a level 0 GoldenBraid part for C-terminal fusionsDepositorInsertCas9 coding region with mutated (D10A, H840A) and inactivated catalytic domains (human codon optimised)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS106a
Plasmid#87382PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS106a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPGK-T7/2-CD44v6-10 (-cyt)
Plasmid#137821Purposeexpression of CD44 proteins in mammalian cellsDepositorInsertCD44v6-10 (-cyt) (CD44 Human)
TagsGFPExpressionMammalianMutationwithout cytoplasmic regionPromoterPGKAvailable SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
SNX6-PX (27-171)
Plasmid#119087PurposeBacterial expression of human phox homology (PX) domain, SNX6-PX (27-171)DepositorAvailable SinceApril 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
LF701: pMAGIC (L1-R5) hU6::xCas9(3.7) gRNA scaffold
Plasmid#121817PurposepMAGIC L1-R5 entry plasmid, contains empty human U6-driven xCas9(3.7) (i.e. SpCas9) gRNA scaffold for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestionDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRD421
Plasmid#163112PurposeProduction of His6_TEV-cleavable-linker_mEos3.2_H-NSdbd in BL21 (DE3) pLysSDepositorInsertHis-tag_TEV-cleavable-linker_mEos3.2_H-NSdbd
TagsHis-tag with TEV-cleavable linkerExpressionBacterialPromoterT7 promoterAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 PA-mCit-GW
Plasmid#113448PurposeProteinA-mCitrine Gateway shuttle vector for N-terminal fusionsDepositorTypeEmpty backboneUseGateway shuttle vectorTagsProteinA-mCitrineExpressionMammalianPromoterCMVAvailable SinceAug. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
SH3PXD2A-PX (1-126)
Plasmid#119115PurposeBacterial expression of human phox homology (PX) domain, SH3PXD2A-PX (1-126)DepositorAvailable SinceMay 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
tRNA-gRNA position [M1_n-1] (GB1210)
Plasmid#75411PurposetRNA and scaffold for the assembly of GBoligomers for the first position (positon [M1_n-1]) of a polycistronic tRNA-gRNA regulated by the (monocot) U3 promoter (2-part multiplexing)DepositorInserttRNA-gRNA position [M1_n-1]
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPB-CAG-Dnmt3a2-Ires2-mCherry-SV40
Plasmid#186969PurposePiggyBac vector encoding mouse Dnmt3a2 with Ires2-mCherry fluorescent marker for expression in mammalian cells.DepositorInsertDnmt3a2 (Dnmt3a Mouse, Synthetic)
UsePiggybacTagsFlagExpressionMammalianMutationIsoform 2 (residues 220–908)PromoterCAGAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-HA-Flag-natT1R2 a22-end_I132S-S212N
Plasmid#113952Purposemammalian expression plasmid for FLAG-tagged human T1R2 with signal peptide of influenza hemagglutinin; expression-enhanced variantDepositorInsertT1R2 (TAS1R2 Human)
TagsFLAG and Signal/leader sequence from influenza he…ExpressionMammalianMutationdelete N-terminal 21 residues, I132S and S212N su…PromotercmvAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pST1374-dCas9-GCN4
Plasmid#113026PurposeExpresses dCas9-GCN4 in mammalian cellsDepositorInsertdCas9-GCN4 (GCN4 Budding Yeast, S. pyogenes)
ExpressionMammalianMutationD10A, H840A, N863APromoterCMVAvailable SinceJuly 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-HA-Flag-natT1R2 a22-end_I132S-S212N-D231G
Plasmid#113953Purposemammalian expression plasmid for FLAG-tagged human T1R2 with signal peptide of influenza hemagglutinin; expression-enhanced variantDepositorInsertT1R2 (TAS1R2 Human)
TagsFLAG and Signal/leader sequence from influenza he…ExpressionMammalianMutationdelete N-terminal 21 residues, I132S, S212N, and …PromotercmvAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2B-SMASh-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin
Plasmid#187949PurposeSMASh degron-tagged dCas9 fused with tagRFPt, P2A site and tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertSMASh-SpdCas9-tagRFPt-P2A-tagBFP
UseCRISPR and Synthetic BiologyTagsGGS linkerExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha2 P35S:MS2:EDLL:Tnos (GB1738)
Plasmid#160622PurposeTU for the constitutive expression of the MS2 coat protein fused on Ct to the activation domain EDLLDepositorInsertP35s_MS2:EDLL_Tnos
ExpressionPlantMutationBsaI and BsmBI sites removedPromoterP35SAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1114a
Plasmid#87397PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1114a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
HT116_pAAV_hSyn-DiO-SomQuasAr6b_EGFP
Plasmid#190879PurposeCre-on expression of soma-targeted QuasAr6b under an neuronal promoterDepositorInsertsoma-targeted QuasAr6b
UseAAVTagsEGFPPromoterhSynAvailable SinceNov. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-moxGFP-Puro-H3C2
Plasmid#207783PurposeDonor template for moxGFP-2A-Puro insertion into the C-terminus of the H3C2 locus for nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H3C2 Addgene #207780DepositorInsertH3C2 Homology Arms flanking a moxGFP-Puro Cassette (H3C2 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits