We narrowed to 10,106 results for: UTY
-
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pB80-KIF1A(1-383)-GFP-SSPB(micro)
Plasmid#174627PurposeConstitutively active KIF1A for optogenetic heterodimerization to iLID via SSPB(micro)DepositorInsertKIF1A(1-383)-GFP-SSPB(micro) (Kif1a Synthetic, Mouse)
TagsGFP-SSPB(micro)ExpressionMammalianMutationmmKIF1A(aa1-383): Pro202Ala; EGFP: Met1Del; SSPB:…PromoterChicken beta-actinAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha2 P35S:MS2-VP64:Tnos (GB1395)
Plasmid#160609PurposeTU for the constitutive expresion of the viral coat protein MS2 fused on C-terminal with the VP64DepositorInsertP35S:MS2-VP64:Tnos
ExpressionPlantMutationBsaI and BsmBI sites removedPromoterP35SAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV-gRNA-Bcan-Ntrk1_4
Plasmid#136413PurposeLentiviral expression of gRNAs targeting intron 13 of murine Bcan and intron 10 of murine Ntrk1. Also constitutively expresses Puromycin linked to TagBFP.DepositorInsertU6_sgRNA(Bcan)_U6_sgRNA(Ntrk1)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV-gRNA-Myb-Qk_1
Plasmid#136415PurposeLentiviral expression of gRNAs targeting intron 4 of murine Qk and intron 9 of murine Myb. Also constitutively expresses Puromycin linked to TagBFP.DepositorInsertU6_sgRNA(Myb)_U6_sgRNA(Qk)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-HLA-A2-VN (G112P)
Plasmid#135496PurposeMammalian expression of VN-fused and myc-tagged HLA-A*02:01 (G112P mutant)DepositorInsertHLA-A*02:01 (HLA-A Human)
TagsExtracellular c-myc epitope tag, Signal peptide f…ExpressionMammalianMutationG112PPromoterCMVAvailable SinceApril 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-HLA-A2-VN (L156P)
Plasmid#135497PurposeMammalian expression of VN-fused and myc-tagged HLA-A*02:01 (L156P mutant)DepositorInsertHLA-A*02:01 (HLA-A Human)
TagsExtracellular c-myc epitope tag, Signal peptide f…ExpressionMammalianMutationL156PPromoterCMVAvailable SinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-H2-Dd-VN (Y84C/C121S/A139C)
Plasmid#135501PurposeMammalian expression of VN-fused and myc-tagged H2-Dd (Y84C/C121S/A139C mutant)DepositorInsertH2-Dd (H2-D1 Mouse)
TagsExtracellular c-myc epitope tag, Signal peptide f…ExpressionMammalianMutationY84C/C121S/A139CPromoterCMVAvailable SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-HLA-A2-VN (I52P)
Plasmid#135486PurposeMammalian expression of VN-fused and myc-tagged HLA-A*02:01 (I52P mutant)DepositorInsertHLA-A*02:01 (HLA-A Human)
TagsExtracellular c-myc epitope tag, Signal peptide f…ExpressionMammalianMutationI52PPromoterCMVAvailable SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-HLA-A2-VN (Y59P)
Plasmid#135492PurposeMammalian expression of VN-fused and myc-tagged HLA-A*02:01 (Y59P mutant)DepositorInsertHLA-A*02:01 (HLA-A Human)
TagsExtracellular c-myc epitope tag, Signal peptide f…ExpressionMammalianMutationY59PPromoterCMVAvailable SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-HLA-A2-VN (D61P)
Plasmid#135493PurposeMammalian expression of VN-fused and myc-tagged HLA-A*02:01 (D61P mutant)DepositorInsertHLA-A*02:01 (HLA-A Human)
TagsExtracellular c-myc epitope tag, Signal peptide f…ExpressionMammalianMutationD61PPromoterCMVAvailable SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-HLA-A2-VN (V67P)
Plasmid#135494PurposeMammalian expression of VN-fused and myc-tagged HLA-A*02:01 (V67P mutant)DepositorInsertHLA-A*02:01 (HLA-A Human)
TagsExtracellular c-myc epitope tag, Signal peptide f…ExpressionMammalianMutationV67PPromoterCMVAvailable SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-HLA-A2-VN (Y84P)
Plasmid#135495PurposeMammalian expression of VN-fused and myc-tagged HLA-A*02:01 (Y84P mutant)DepositorInsertHLA-A*02:01 (HLA-A Human)
TagsExtracellular c-myc epitope tag, Signal peptide f…ExpressionMammalianMutationY84PPromoterCMVAvailable SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-HLA-A2-VN (E166P)
Plasmid#135498PurposeMammalian expression of VN-fused and myc-tagged HLA-A*02:01 (E166P mutant)DepositorInsertHLA-A*02:01 (HLA-A Human)
TagsExtracellular c-myc epitope tag, Signal peptide f…ExpressionMammalianMutationE166PPromoterCMVAvailable SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLX304 PCSK5 (R511C)-V5 blast
Plasmid#83104PurposeLentiviral vector for constitutive expression of human mutant PC5A (R511C) with C-terminal V5 tagDepositorInsertPCSK5 (PCSK5 Human)
UseLentiviralTagsV5ExpressionMammalianMutationChanged Arginine 511 to CysteineAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLX304 PCSK5 (T288P)-V5 blast
Plasmid#83101PurposeLentiviral vector for constitutive expression of human mutant PC5A (T288P) with C-terminal V5 tagDepositorInsertPCSK5 (PCSK5 Human)
UseLentiviralTagsV5ExpressionMammalianMutationChanged Threonine 288 to ProlineAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLX304 PCSK5 (A270T)-V5 blast
Plasmid#83102PurposeLentiviral vector for constitutive expression of human mutant PC5A (A270T) with C-terminal V5 tagDepositorInsertPCSK5 (PCSK5 Human)
UseLentiviralTagsV5ExpressionMammalianMutationChanged Alanine 270 to ThreonineAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLX304 PCSK5 (H516P)-V5 blast
Plasmid#83103PurposeLentiviral vector for constitutive expression of human mutant PC5A (H516P) with C-terminal V5 tagDepositorInsertPCSK5 (PCSK5 Human)
UseLentiviralTagsV5ExpressionMammalianMutationChanged Histidine 516 to ProlineAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-HF1-P2A-Puro
Plasmid#110850PurposeLentiviral vector for constitutive expression of Cas9-HF1 (not codon optimized)DepositorInsertCas9-HF1
UseLentiviralTags3X FLAGMutationN497A, R661A, Q695A, Q926APromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VQR-PGK-Puro
Plasmid#110855PurposeLentiviral vector for constitutive expression of Cas9-VQR (not codon optimized)DepositorInsertCas9-VQR
UseLentiviralTags3X FLAGMutationD1135V, R1335Q, T1337RPromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VRER-PGK-Puro
Plasmid#110856PurposeLentiviral vector for constitutive expression of Cas9-VRER (not codon optimized)DepositorInsertCas9-VRER
UseLentiviralTags3X FLAGMutationD1135V, G1218R, R1335E, T1337RPromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VRER-P2A-Puro
Plasmid#110849PurposeLentiviral vector for constitutive expression of Cas9-VRER (not codon optimized)DepositorInsertCas9-VRER
UseLentiviralTags3X FLAGMutationD1135V, G1218R, R1335E, T1337RPromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLX302 PCSK5 (T288P)-V5 puro
Plasmid#98709PurposeLentiviral vector for constitutive expression of human mutant PC5A (T288P) with C-terminal V5 tagDepositorInsertPCSK5 (PCSK5 Human)
UseLentiviralTagsV5ExpressionMammalianMutationChanged Threonine 288 to ProlineAvailable SinceAug. 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pENTR-2B-Nkx2-5YRD Y-A
Plasmid#98611PurposeGateway entry vector for NKX2-5 YRD Y-ADepositorInsertNKX2-5 YRD Y-A (Nkx2-5 Mouse)
UseEntry vectorMutationSubstitutions of 7 tyr into Ala residues.Y233A; Y…Available SinceAug. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pENTR1A DHFR.dn-cHSF1
Plasmid#134726PurposeGateway entry vector for constitutively active dominant-negative HSF1 fused to the DHFR destabilized domainDepositorAvailabilityAcademic Institutions and Nonprofits only -
CRISPR-SB
Plasmid#177936PurposeExpresses SpCas9 and sgRNA. Can be integrated into the genome upon co-delivery of Sleeping Beauty transposase.DepositorTypeEmpty backboneUseCRISPR; TransposonExpressionMammalianPromoterU6Available SinceNov. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
mCherry-MUTHY
Plasmid#215132PurposeExpresses mCherry-MUTHY in mammalian cells from a retroviral vector.DepositorAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xEcoLeuT(CUA)_AnapRS
Plasmid#140019PurposePlasmid with 4xEcoLeuT(CUA) cassette and E. coli AnapRS for amber suppression and incorporation of the fluorescent ncAA Anap; for transient or stable piggyBac-mediated integrationDepositorInsertEcoLeuRS (AnapRS)
ExpressionMammalianMutationL38F, M40G, L41P, Y499V, Y500L, Y527A, H537E, L53…PromoterEF1Available SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pT2-hUbC-dCas9-KRAB-T2a-Puro
Plasmid#225999PurposeTo establish stable dCas9-KRAB knock-in lineDepositorInserthumanized dCas9-KRAB T2A Puro
UseSleeping beauty transposonExpressionMammalianMutationD10A and H840AAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDEST-CMV 3xFLAG-GABARAPL1-GFP
Plasmid#123112PurposeExpresses 3xFLAG-GABARAPL1-EGFP in mammalian cells, for monitoring ATG4 activity towards GABARAPL1DepositorInsertGamma-aminobutyric acid receptor-associated protein-like 1 (GABARAPL1 Human)
Tags3xFLAG and EGFPExpressionMammalianPromoterCMVAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDEST-CMV 3xFLAG-GABARAPL2-GFP
Plasmid#123113PurposeExpresses 3xFLAG-GABARAPL2-EGFP in mammalian cells, for monitoring ATG4 activity towards GABARAPL2DepositorInsertGamma-aminobutyric acid receptor-associated protein-like 2 (GABARAPL2 Human)
Tags3xFLAG and EGFPExpressionMammalianPromoterCMVAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV 3xFLAG-GABARAPL2 G116
Plasmid#123105PurposeExpresses 3xFLAG-GABARAPL2 G116 in mammalian cells.DepositorInsertGamma-aminobutyric acid receptor-associated protein-like 2 (GABARAPL2 Human)
Tags3xFLAGExpressionMammalianMutationDeleted amino acid 117. Stop codon after G116PromoterCMVAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-SPRED1-3'UTR (WT - miR-206 site)
Plasmid#62577PurposeTranslational Luciferase Reporter containing a fragment of the 3'UTR of SPRED1 containing a miR-206 binding siteDepositorInsertSPRED1 (SPRED1 Human)
UseLuciferaseAvailable SinceMay 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-FAP-TGN38-GFP
Plasmid#242992PurposeInducible FAP-TGN38-GFP expression in mammalian cellsDepositorInsertdH6.2-TGN38-GFP (Tgoln2 Rat)
UseSleeping beautyTagsFAP and GFPExpressionMammalianPromoterTight TREAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-GFP-TGN38-FAP
Plasmid#242993PurposeInducible GFP-TGN38-FAP expression in mammalian cellsDepositorInsertGFP-TGN38-dH6.2 (Tgoln2 Rat)
UseSleeping beautyTagsFAP and GFPExpressionMammalianPromoterTight TREAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-mCer3-TGN38-FAP
Plasmid#242994PurposeInducible mCer3-TGN38-FAP expression in mammalian cellsDepositorInsertmCer3-TGN38-dH6.2 (Tgoln2 Rat)
UseSleeping beautyTagsFAP and mCer3ExpressionMammalianPromoterTight TREAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDEST-CMV GFP-GABARAPL1 G116
Plasmid#123119PurposeExpresses EGFP-GABARAPL1 G116 in mammalian cells.DepositorInsertGamma-aminobutyric acid receptor-associated protein-like 1 (GABARAPL1 Human)
TagsEGFPExpressionMammalianMutationDeleted amino acid 117. Stop codon after G116PromoterCMVAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-SPRED1-3'UTR (containing miR-21 sites)
Plasmid#62579PurposeTranslational Luciferase Reporter encoding a fragment of the 3'UTR of SPRED1 containing two miR-21 binding sites (sites 1 and 2)DepositorInsertSPRED1 (SPRED1 Human)
UseLuciferaseAvailable SinceJune 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
eMscL G22S
Plasmid#107455PurposeeMscL G22S is optimized for mammalian rodent neuronal expression to the plasma membrane through a neuron-specific promoter and a voltage-gated channel targeting motifDepositorInsertbacterial mechanosensitive ion channel of large conductance (mscL Escherichia coli)
UseAdeno-associated viralTagsKir2.1 ER export signal (FCYENEV) and tdTomato fl…ExpressionMammalianMutationBearing a glycine to serine substitution at posit…Promoterhuman synapsin 1Available SinceApril 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-5'Luciferase(split CAGGT)_BDlacZ-SV40polyA
Plasmid#216320PurposeSplit luciferase assay to test reconstitution via mRNA trans-splicing (REVeRT system).DepositorInsertSplit Luciferase + splice donor site
UseAAVPromoterCMVAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-BDLacZ-SAS620-3'Luciferase (split CAGGT)-SV40pA
Plasmid#216321PurposeSplit luciferase assay to test reconstitution via mRNA trans-splicing (REVeRT system).DepositorInsertSplit Luciferase + splice acceptor site
UseAAVPromoterCMVAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKI_ΩBBMVP16&SRDXWUSm1
Plasmid#220349PurposeExpresses BBM-VP16 and SRDX-WUSm1 in plant cellsDepositorTagsSuperman Repression Domain X (SRDX) and VP16 tran…ExpressionPlantMutationtwo amino acid substitution in WUS-box: L255A L25…PromoterCaMV 35S and RPS5AAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
CXCR5-DuET
Plasmid#213222PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
PET01-TAF5-ex8-Minigene-SRSF1 motif WT
Plasmid#218972PurposeVector for constitutive expression of TAF5 alternative exon-8 mini gene with wild type SRSF1 motif (TCAGAGGA)DepositorInsertTAF5 exon-8 (with wild type SRSF1 motif )and the native flanking intronic sequences spanning the exon-8
ExpressionMammalianPromoterRSV LTRAvailable SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRL_GI_PCB28
Plasmid#98745PurposeFor phycocyanobilin production in Saccharomyces cerevisiae. Contains integrative cassette for the yeast his1-Δ200 locus. Encodes constitutively expressed HY1 and PcyA.DepositorInsertsUseSynthetic BiologyExpressionYeastMutationCodon optimized for Saccharomyces cerevisiaePromoterADH1m and PGK1Available SinceAug. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV2.1-CMV-5'Cer-BDlacZ-bGHpA
Plasmid#216318PurposeSplit fluorophore assay to test reconstitution via mRNA trans-splicing (REVeRT system).DepositorInsertsplit cerulean fluorescent protein + splice donor site
UseAAVPromoterCMVAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
3` CC: Hygro – GFP-N – loxP – mScarlet
Plasmid#219564Purpose3` circularization cassette.To induce Cre-mediated circularization or inversion of a genomic region with concomitant GFP reconstitution and mScarlet expression from the chromosomeDepositorInsert3` CC: Hygro – GFP-N – loxP – mScarlet
UseUnspecifiedPromoterEF1-aAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
CCR7-DuET
Plasmid#213203PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
GPR156-DuET
Plasmid#213267PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-beta-catenin deltaN90
Plasmid#36985DepositorInsertbeta-catenin deltaN90 (CTNNB1 Human)
UseLentiviralTagsMycExpressionMammalianMutationDeletion of amino acids 1-90 (Constitutively Acti…PromoterEF1aAvailable SinceSept. 6, 2012AvailabilityAcademic Institutions and Nonprofits only