We narrowed to 15,826 results for: grna
-
Plasmid#212963PurposeLentiviral plasmid for the measurement of RfxCas13d (CasRx) nuclease activity. As a marker, the plasmid also encodes the tRFP657 fluorescence protein.DepositorInsertDR1_CasRx_GFP targeting spacer
UseCRISPR and LentiviralTagsTagRFP657ExpressionMammalianMutationPromoterU6Available SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKL038 Lenti U6 dCas12a gRNA Puro mCherry
Plasmid#195546PurposedCas12a gRNA expression backboneDepositorInsertLenti U6- empty cassette_Direct repeat_puro_mcherry
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-BsmBI_cassette-Nme/Nme2Cas9-sgRNA (KAC32)
Plasmid#133794PurposeU6 promoter sgRNA entry vector used for all NmeCas9 or Nme2Cas9 sgRNAs (clone spacer oligos into BsmBI cassette) - similar to sgRNA architecture from Amrani et al. Genome Biology 2018DepositorInsertNmeCas9 and Nme2Cas9 sgRNA entry vector
UseTagsExpressionMammalianMutationsgRNA architecture from Amrani et al. Genome Biol…PromoterU6Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-AsCpf1-2A-GFP-U6-sgRNA-cloning vector
Plasmid#159281PurposeA multicistronic vector with both CAGGS promoter-driven AsCpf1 and U6 promoter-driven single guide RNA (sgRNA)DepositorInsertAsCpf1-HA-2A-GFP
UseMulticistronic vector with both caggs promoter-dr…Tags3X HAExpressionMammalianMutationPromoterU6Available SinceSept. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
Pzac2.1 U6-control sgRNA1, 2, 3_gfaABC1D mcherry SV40
Plasmid#179120PurposeExpresses control sgRNAs under the U6 promoter and mcherry protein specifically in astrocytesDepositorInsertcontrol sgRNA
UseAAVTagsExpressionMutationPromoterU6Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-TadA8e-Sauri-U6-sgRNA scaffold
Plasmid#226921PurposeEncoding SauriABE8e and sgRNA cassette on a single AAVDepositorInsertTadA8e, nSauriCas9
UseAAVTagsExpressionMutationPromoterEFSAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV_hU6-sgRNA_hUbC-dSaCas9-KRAB-T2A-PuroR
Plasmid#162334PurposeLentiviral expression of dSaCas9-KRAB and a sgRNA with puromycin resistanceDepositorInsertdSaCas9-KRAB
UseLentiviralTagsHAExpressionMammalianMutationPromoterhUbCAvailable SinceFeb. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSimpleII-U6-sgRNA-BsmBI-NLS-NmCas9-HA-NLS
Plasmid#115694PurposeAll-in-one plasmid. Contains expression cassette for NmeCas9 with N and C NLS and HA tag at the C, plus cassette (for cloning of spacer in BsmBI) for expressing sgRNA under the control of U6 promoter.DepositorInsertsNmeCas9
Nme-sgRNA
UseCRISPRTagsNLS and NLS, HAExpressionInsect and MammalianMutationNone and fusion of repeat/tracrRNA to make a sgRNAPromoterEF-1 alpha and U6Available SinceSept. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eSpCas9-2A-GFP-sgRNA-DNA-PKcs
Plasmid#220493PurposeTo generate DNA-PKcs KO in human cells. Co-expresses eSpCas9(1.1), GFP and a guide RNA against DNA-PKcs exon 1.DepositorInsertsgRNA targeting DNA-PKcs (PRKDC) exon 1 (PRKDC Human)
UseCRISPRTagsExpressionMutationPromoterU6Available SinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-U6-gRNA-UbC-eGFP-P2A-Bsr
Plasmid#83925PurposeLentiviral SpCas9-gRNA expression vector with eGFP-P2A-BlastRDepositorInsertseGFP
Bsr
UseCRISPR and LentiviralTagsP2AExpressionMutationPromoterhUbCAvailable SinceApril 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDAS12230_pegRNA-PEAR-GFP(10PBS-24RT)-mCherry
Plasmid#177182Purposeplasmid expressing a pegRNA targeting the PEAR-GFP plasmid along with an mCherry markerDepositorInsertpegRNA targeting the PEAR-GFP plasmid
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available SinceFeb. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
Pzac2.1 U6-Ezr sgRNA1, 2, 3_gfaABC1D mcherry SV40
Plasmid#179119PurposeExpresses Ezr sgRNAs under the U6 promoter and mcherry protein specifically in astrocytesDepositorInsertEzr sgRNA
UseAAVTagsExpressionMutationPromoterU6Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgRNAs-del-CDK5RAP2-SVA-BFP
Plasmid#202824PurposeLentiviral vector modified to express two sgRNAs that delete the intronic SVA within the CDK5RAP2 gene with EF-1apha for Cas9 and BFP expressionDepositorInserttwo sgRNAs (each with a U6 promoter) to delete SVA within CDK5RAP2 gene
UseLentiviralTagsExpressionMammalianMutationPromoterU6 - twoAvailable SinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
lenti-EGFR-L858R-T790M-dual-epegRNA
Plasmid#214100PurposeLentiviral vector expressing epegRNAs for the induction of EGFR L858R and T790M mutations, through tandem U6 expression of the two epegRNAs using independent U6 promoters.DepositorInsertEGFR L858R epegRNA/EGFR T790M epegRNA
UseLentiviralTagsExpressionMammalianMutationPromoterhU6Available SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BbsI)sgRNA_CAG-Cas9-venus-bpA
Plasmid#86986PurposeFor cloning and expression of sgRNA together with expression of a Cas9-Venus fusion proteinDepositorInsertCas9-venus
UseTagsCas9-Venus fusion proteinExpressionMammalianMutationPromoterCAGAvailable SinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA EF1Alpha-puro-T2A-BFP.CYRANO
Plasmid#128755PurposeExpresses CYRANO gRNA for CRISPRiDepositorInsertCYRANO sgRNA (OIP5-AS1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromotermU6Available SinceAug. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP316-pAAV-U6SaCas9gRNA(SapI)-pA Empty Cassette
Plasmid#113693PurposeU6 driven SaCas9 gRNA expression cassette without a gRNA. SapI can be used to clone in gRNAs.DepositorInsertSaCas9 gRNA Cassete
UseAAV and CRISPRTagsExpressionMutationPromoterAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEG302 22aa SunTag VP64 gRNA4 (FWA)
Plasmid#120249PurposeCRISPR-Cas9 SunTag system to target VP64 to the FWA locus with a single guide RNADepositorInsertg4_U6_NOS_NLS_GB1_NLS_linker_VP64_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_3xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationPromoterAvailable SinceApril 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-RNF2-tevopreQ1-epegRNA+5G>T_EF1a-puroR
Plasmid#207355PurposeLentiviral transfer plasmid encoding hU6-driven expression of a RNF2 engineered prime editing guide (epegRNA) and EF1a-driven puromycin resistance gene.DepositorInsertRNF2 + 5G>T tevopreq1-prime editing guide RNA (epegRNA)
UseLentiviralTagsExpressionMutationPromoterAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pShHELIX(Cas12k-TniQ-TniQ)-sgRNA_entry (CJT112)
Plasmid#181791PurposeExpresses 3-component ShHELIX containing a Cas12k-TniQ-TniQ fusion. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertnAniI-ShTnsB, ShTnsC, ShCas12k-ShTniQ-ShTniQ
UseTagsExpressionBacterialMutationnAniI = K227M, F80K, L232KPromoterLac and J23119Available SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL3-U6-sgRNA-PGK- mRFP-T2A-PuroR
Plasmid#194925PurposemRFP and T2A linker are inserted in between the hPGK promoter and the puromycin resistance gene (PuroR) on pGL3-U6-sgRNA-PGK-puromycin to allow simultaneous monitoring and enrichment of transfected hoDepositorTypeEmpty backboneUseCRISPRTagsExpressionMutationPromoterhPGKAvailable SinceMay 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX552-EF1a-DIO-mcherry(with gRNA scaffold)
Plasmid#199581PurposeExpresses mCherry in a Cre-dependent mannerDepositorInsertmCherry
UseAAV, CRISPR, and Cre/LoxTagsExpressionMammalianMutationPromoterEF1a intron A and U6Available SinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-dSaCas9-KRAB-gRNA-TRE-blast
Plasmid#201151PurposeLentiviral expression of S. aureus dead Cas9 (dCas9/dSaCas9/SadCas9) fused to the KRAB domain as well as a gRNA targeting the tight TRE promoter and the blasticidin resistance gene.DepositorInsertsSadCas9-KRAB
gRNA-TRE
UseCRISPR and LentiviralTagsHAExpressionMutationgRNA sequence: ATCAGTGATAGAGAACGTATGPromoterAvailable SinceJuly 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEG302 22aa SunTag NtDRMcd gRNA4 (FWA)
Plasmid#115486PurposeCRISPR-Cas9 SunTag system to target NtDRMcd to the FWA locus with a single guide RNADepositorInsertg4_U6_NOS_NLS_GB1_NLS_linker_DRMcd_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_3xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationPromoterAvailable SinceApril 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRRL-gRNA(anti-cGAS)-Cas9-Puro
Plasmid#130908PurposegRNA targeting human cGAS; Cas9 insert; Puromycin selection markerDepositorInsertCas9
UseTagsExpressionMammalianMutationPromoterAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
SLBP non-targeting gRNA lambda phage
Plasmid#132548Purposeexpresses gRNA for SLBP-based CIRTSDepositorInsertgRNA SLBP-based CIRTS
UseTagsExpressionMammalianMutationPromoterhU6 promoterAvailable SinceSept. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-U6-SpyCas9-TLR-MCV1-sgRNA1
Plasmid#117405PurposeSpyCas9 sgRNA 1 targeting TLR2.0DepositorInsertSpyCas9 sgRNA targeting TLR 2.0
UseLentiviralTagsExpressionMammalianMutationPromoterU6Available SinceDec. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA EF1Alpha-puro-T2A-BFP.Control
Plasmid#128749PurposeExpresses control gRNADepositorInsertControl sgRNA
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromotermU6Available SinceOct. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
Pzac2.1 U6-Fermt2 sgRNA1, 2, 3_gfaABC1D mcherry SV40
Plasmid#179117PurposeExpresses Fermt2 sgRNAs under the U6 promoter and mcherry protein specifically in astrocytesDepositorInsertFermt2 sgRNA
UseAAVTagsExpressionMutationPromoterU6Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-RSV-GFP-U6-gRNA scaffold (SpyCas9)
Plasmid#113039PurposeAAV vector; encodes GFP as well as a U6-driven gRNA scaffold (SpyCas9)DepositorInsert2x BbsI sites - SpCas9 scaffold, co-expressed GFP (transfection marker)
UseAAVTagsExpressionMammalianMutationPromoterAvailable SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only