We narrowed to 9,971 results for: Gnas
-
Plasmid#213297PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only
-
GPRC5A-DuET
Plasmid#213295PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
GPR174-DuET
Plasmid#213271PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
GPR160-DuET
Plasmid#213268PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
GPBA-DuET
Plasmid#213255PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
FPR2-DuET
Plasmid#213240PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
CYSLTR2-DuET
Plasmid#213226PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
ADRB1-DuET
Plasmid#213180PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
ADRA2B-DuET
Plasmid#213178PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-EFNB2 (D62Q)
Plasmid#200976PurposeMammalian expression plasmid for myc-tagged EFNB2 (D62Q specificity mutant)DepositorInsertEFNB2 (EFNB2 Human)
TagsExtracellular c-myc epitope tag and Signal peptid…ExpressionMammalianMutationD62Q (increases specificity towards henipaviral G…PromoterCMVAvailable SinceOct. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-bio-myc-mCE 211-597
Plasmid#112716PurposeExpresses N-terminally bio-myc-tagged mouse CE/Rngtt 211-597 in mammalian cellsDepositorInsertRngtt (Rngtt Mouse)
Tagsbiotinylation signal peptide (Tagwerker et al. 20…ExpressionMammalianMutationdeleted amino acids 2-210 (triphosphatase domain)PromoterCMVAvailable SinceSept. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAW-BiP-Nb127D01-mCherry-KDEL
Plasmid#171575PurposeExpresses mCherry-tagged anti-CXCR2 (human) recombinant llama nanobody (Nb127D01-mCherry) in fly cell ER membraneDepositorInsertBiP-Nb127D01-mCherry-KDEL (CXCR2 Human)
TagsBiP signal peptide and mCherry-KDELExpressionInsectPromoterfly actin5C promoterAvailable SinceAug. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAW-BiP-NbVHH05-mCherry-KDEL
Plasmid#171574PurposeExpresses mCherry-tagged anti-UBC6e (human) recombinant alpaca nanobody (NbVHH05-mCherry) in fly cell ER membraneDepositorInsertBiP-NbVHH05-mCherry-KDEL (UBE2J1 Human)
TagsBiP signal peptide and mCherry-KDELExpressionInsectPromoterfly actin5C promoterAvailable SinceJune 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
p35S_GFP-EVDinter-GUS
Plasmid#167123PurposePlant binary expression vector containing the intron and proximal polyadenylation signal sequences of the Copia93 retroelement EVADE (AT5G17125) between mGFP5 and GUS under CaMV 35S promoter.DepositorInsertEVADE GAG intron and terminator (EVD_in/ter) (AT5G17125 Mustard Weed)
TagsGUS and mGFP5ExpressionPlantPromoterCaMV 35SAvailable SinceApril 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-GFP-EBA175-Flag(E1418K/A1419R/S1421R/P1424Q/Y1426S)
Plasmid#155010PurposeExpresses N-terminally GFP-tagged and C-terminally Flag-tagged EBA175 E1418K/A1419R/S1421R/P1424Q/Y1426S variant (residues 1284-1462) from pcDNA3.1DepositorInsertPfEBA175
TagsFlag, GFP, and signal peptide (residues 1 to 32) …ExpressionMammalianMutationE1418K/A1419R/S1421/P1424Q/Y1426S; insert codes f…PromoterCMVAvailable SinceNov. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-X1-Neo-TOM20MTS-DDRGK1-dTM-HA
Plasmid#139861PurposeLentiviral expression of TOM20MTS-DDRGK1-dTM-HADepositorInsertTOM20-MTS-DDRGK1-dTM (DDRGK1 Human)
UseLentiviralTagsHAMutationrecombinant fusion of mitochondria-targeting sign…Available SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc [ArchT-tdTomato]
Plasmid#123607PurposeAAV mediated expression of ArchT-tdTomato under the Syn promoter, in floxed/reversed (Cre-dependent) manner. tdTomato has codons varied to reduce recombination. Using bGHpA signal.DepositorInsertArchT-tdTomato
UseAAVTagstdTomatoExpressionMammalianPromoterSynAvailable SinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
Rescue myc-PCDHGC5 mRNA
Plasmid#122229PurposeRescue mRNA for Protocadherin gamma C5 knock down with sh1 shRNA (plasmid 122227). With five silent mutations at sh1 shRNA target site.DepositorInsertPCDHGC5 (Pcdhgc5 Rat)
Tags9E10 cMyc epitope (EQKLISEEDL) was inserted betwe…ExpressionMammalianMutationSilent mutations are in five consecutive codons …Available SinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25K3
Plasmid#122242PurposeExpresses a dominant negative Kash construct that disrupts LINC complexes in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianPromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEVOL-pAzF[TAG]
Plasmid#164579PurposeMachinery plasmid containing two copies of the Mj pCNFRS and cognate tRNA for incorporation of pAzF, pCNF, or pENF at TAG codonsDepositorInsertsMj pCNFRS[TAG] (aaRS1)
Mj pCNFRS[TAG] (aaRS2)
Mj tRNA[TAG]
ExpressionBacterialMutationY32L L65V F108W Q109M D158G I159PPromoteraraBAD, glnS, and proKAvailable SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn CaBLAM
Plasmid#244227PurposeBioluminescent reporter for calcium signaling in neuronsDepositorInsertsmNeonGreen
CaBLAM
UseAAVAvailable SinceNov. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCMV_HyPer7RgDAAO
Plasmid#217653PurposeExpresses the fusion of HyPer7,a H2O2 sensor, and Rhodotorula gracilis D amino acid oxidase (DAAO) to measure transport of D amino acids across the plasma membraneDepositorInsertHyPer7 D amino acid oxidase
UseLentiviralTagsNuclear export signalExpressionMammalianMutationFused DAAO to the C-terminus of HyPer7 using a Gl…PromoterCMVAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pB–DualPE
Plasmid#235161PurposeFor plant prime editing including large DNA fragment editing in wheat plants or other monocotyledonsDepositorInsertsCsy4-P2A-Nls-nCas9-NC-nls-MLV-Nls
CmYLCV-epegRNA-CaMV poly(A) signal
UseCRISPRMutationDetailed in manuscriptAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
Flag_HsIRE1a_deltaP29_D408_pBabePuro
Plasmid#58422Purposeretroviral pBabe puro vector encoding N-terminally FLAG tagged mutant human IRE1a deleted from amino acids P28 to D408DepositorInsertIRE1a (ERN1 Human)
UseRetroviralTagsFLAG and preprotrypsin signal sequenceExpressionMammalianMutationDeleted amino acids P29 to D408Available SinceSept. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV GFAP CaBLAM
Plasmid#244228PurposeBioluminescent reporter for calcium signaling in astrocytesDepositorInsertsmNeonGreen
CaBLAM
UseAAVAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α-FLEX-rc[Chronos-GFP]
Plasmid#62725PurposeAAV-mediated expression of Chronos-GFP under the EF1α promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterEF1αAvailable SinceApril 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLEX-rc [Chronos-tdTomato]
Plasmid#84484PurposeAAV-mediated expression of Chronos-tdTomato under the CAG promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal. tdTomato is a codon diversified version.DepositorInsertChronos-tdTomato
UseAAVTagstdTomatoExpressionMammalianPromoterCAGAvailable SinceApril 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-STAT3mts
Plasmid#195577PurposeExpresses STAT3 with mitochondrial targeting sequenceDepositorInsertSignal transducer and activator of transcription 3 (Stat3 Mouse)
UseAAVTagsCox8 presequenceExpressionMammalianPromoterCMV enhancer and promoterAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Mito-Car-GECO
Plasmid#100765PurposeLentiviral tet-inducible expression of mito-targeted genetically encoded Ca2+-indicators for optical imagingDepositorInsertLenti-Mito-Car-GECO
UseLentiviralTagsa duplex of the mitochondrial targeting signal of…ExpressionMammalianMutationR-GECO1: E163V/I166V/V174T/M176I/F222I/A302PPromoterCMVAvailable SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
rag2:myr-Akt2_pISceI
Plasmid#231495PurposeExpresses myristolated Akt2 in zebrafish lymphoid and mesenchymal cellsDepositorAvailable SinceJune 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNUT N6His Y95F/Y188F/Y426F/Y517F hTFNG hTFNG
Plasmid#70085PurposeExpresses N-His tagged nonglycosylated human serum transferrin unable to bind iron in either the N-lobe or the C-lobeN-lobeDepositorInsertmutated human serum transferrin (TF Human)
TagsHexa His tag and N-terminal signal peptide, 4 aa …ExpressionMammalianMutationAsn413 Asp, Asn611Asp, Tyr95Phe, Tyr188Phe, Ty426…PromoterSV40Available SinceNov. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV hPGRN
Plasmid#213682PurposeExpresses human progranulin (PGRN) with an N-terminal twin-Strep-V5 tagDepositorInsertHuman Progranulin (hPGRN) (GRN Human)
UseAAVTagsTwin-Strep tag and V5 tag (after signal peptide)Promotercytomegalovirus enhancer/chicken β-actin promoterAvailable SinceDec. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-26b-Nb127D01-ALFA-His
Plasmid#171568PurposeBacterial expression of ALFA-His-tagged anti-CXCR2 (human) recombinant llama nanobody (Nb127D01-ALFA-His)DepositorInsertNb127D01-ALFA-His (CXCR2 Human)
TagsALFA-tag/His-tag and PelB signal peptideExpressionBacterialAvailable SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pScalps_Puro_mTet2 catalytic domain HxD
Plasmid#79611PurposeExpression of catalytically inactive mouse Tet2DepositorInsertTet2 (Tet2 Mouse)
UseLentiviralTagsMycMutationMutant Tet2 with H1302Y, D1304A substitutions in …Available SinceJuly 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc[Chronos-GFP]
Plasmid#62722PurposeAAV-mediated expression of Chronos-GFP under the Syn promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterhuman synapsin promoterAvailable SinceApril 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
p2K7bsdUBI-mCherry-STIM1
Plasmid#114178PurposeLentiviral vector for expression of mCherry-STIM1DepositorInsertSTIM1 (STIM1 Human)
UseLentiviralTagsmCherry (inserted after signal peptide)ExpressionMammalianPromoterUbiquitinAvailable SinceSept. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc[CoChR-GFP]
Plasmid#62724PurposeAAV-mediated expression of CoChR-GFP under the Syn promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertCoChR-GFP
UseAAVTagsGFPExpressionMammalianPromoterhuman synapsin promoterAvailable SinceApril 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
eGFP-proα2(I)-G610C
Plasmid#119827PurposeExpresses mouse Type I procollagen α2 chain (Col1a2) with Gly610Cys mutation and GFP between signal sequence and exon 6DepositorInsertType I procollagen α2 chain (Col1a2 Mouse)
TagseGFPExpressionMammalianMutationCol1a2 exons 2-5 replaced by fluorescent tag, Gly…PromoterCMVAvailable SinceJan. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
LPAR1-DuET
Plasmid#213329PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1442 - pAAV CMV-IE Nuc-iRFP-2A-iCre
Plasmid#112683PurposeAn AAV vector that expresses a nuclear-localized iRFP713 reporter and improved Cre recombinaseDepositorInsertiRFP713
UseAAVTags2A-iCre and Nuclear localization signalPromoterCMV-IEAvailable SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
CRHR1-DuET
Plasmid#213215PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTR1a-mCherry-STIM1
Plasmid#114176PurposeGateway entry clone containing mCherry-STIM1DepositorAvailable SinceSept. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pOT_4 - lenti-EFS-FMC6.3-BBz-2A-puro-2A-LTBR
Plasmid#181973PurposeExpresses anti-CD19 CAR (with 4-1BB signaling domain) linked to puromycin resistance via P2A and to human LTBR via T2A for lentiviral delivery.DepositorInsertFMC6.3-BBz CAR; LTBR (LTBR Synthetic, Human)
UseLentiviralAvailable SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.NWS.VSVg_NGFR
Plasmid#158243PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.NWS.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-FLAG-TAPBPR-TM-VC
Plasmid#135499PurposeMammalian expression of VC-fused and FLAG-tagged TAPBPR with MHC TMDepositorInsertTAPBPR (TAPBPL Human)
TagsLuminal/Extracellular FLAG epitope tag, Signal pe…ExpressionMammalianMutationswitched transmembrane domain with that of MHC-IPromoterCMVAvailable SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOT_3 - lenti-EFS-FMC6.3-28z-2A-puro-2A-LTBR
Plasmid#181972PurposeExpresses anti-CD19 CAR (with CD28 signaling domain) linked to puromycin resistance via P2A and to human LTBR via T2A for lentiviral delivery.DepositorInsertFMC6.3-28z CAR; LTBR (LTBR Synthetic, Human)
UseLentiviralAvailable SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.FLAG.VSVg_NGFR
Plasmid#158245PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.FLAG.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_NWS.FLAG.VSVg_NGFR
Plasmid#158233PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsNWS.FLAG.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only