We narrowed to 16,891 results for: Por
-
Plasmid#161178PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits
-
pDONR221-SLC25A33_STOP
Plasmid#161159PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-SLC22A24_STOP
Plasmid#161166PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-SLC22A9_STOP
Plasmid#161167PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-SLC24A5_STOP
Plasmid#161168PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-SLC25A24_STOP
Plasmid#161146PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-SLC22A23_STOP
Plasmid#161154PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-SLC25A23_STOP
Plasmid#161134PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-SLC25A31_STOP
Plasmid#161135PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-SLC22A20P_STOP
Plasmid#161142PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-SLC16A8_STOP
Plasmid#161125PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-SLC12A5_STOP
Plasmid#161110PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-SLC16A14_STOP
Plasmid#161092PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-SLC13A4_STOP
Plasmid#161099PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-MPC1L_STOP
Plasmid#161084PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-SLC16A5_STOP
Plasmid#161089PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-RHCG_STOP
Plasmid#161061PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-SLC12A1_STOP
Plasmid#161062PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-SLC16A13_STOP
Plasmid#161041PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-RHBG_STOP
Plasmid#161049PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
Myc-KLC1 delta Tail
Plasmid#166965PurposeExpresses Myc-tagged KLC1 protein (1-495 aa) in pcDNA3.1DepositorAvailable SinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
FLAG-KIF5AR280H
Plasmid#166957PurposeExpresses FLAG-tagged KIF5A R280H protein in pcDNA3.1DepositorInsertKIF5A-R280H (Kif5a Mouse)
UseTagsFLAGExpressionMammalianMutationKIF5A-R280HPromoterCMVAvailable SinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
RG6-BAP1_E11
Plasmid#154025PurposeBichromatic Fluorescent Splicing Reporter Minigene for Wild-Type BAP1 Exon 11DepositorInsertBAP1 Exon 11 Fused to DsRed1 and eGFP (BAP1 Human)
UseSplicing reporterTagsDsRed1, FLAG, SV40 NLS, and eGFPExpressionMammalianMutationPromoterAvailable SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
RG6-BAP1_E7
Plasmid#154023PurposeBichromatic Fluorescent Splicing Reporter Minigene for Wild-Type BAP1 Exon 7DepositorInsertBAP1 Exon 7 Fused to DsRed1 and eGFP (BAP1 Human)
UseSplicing reporterTagsDsRed1, FLAG, SV40 NLS, and eGFPExpressionMammalianMutationPromoterAvailable SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
ST-2xTstem(5A)-GFP
Plasmid#162504PurposeExpresses a ST6GAL1 mutant with a GFP tag in its C-terminus in mammalian cells. One wildtype Tac stem region is inserted within ST and the other mutated Tac stem region is inserted between ST and GFP.DepositorUseTagsGFPExpressionMammalianMutationOne Tac stem region is inserted within ST6Gal1 an…PromoterAvailable SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
ST-2xTstem-GFP
Plasmid#162503PurposeExpresses a ST6GAL1 mutant with a GFP tag in its C-terminus in mammalian cells. One Tac stem region is inserted within ST and the other Tac stem region is inserted between ST and GFP.DepositorUseTagsGFPExpressionMammalianMutationOne Tac stem region is inserted within ST6Gal1 an…PromoterAvailable SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-TUSC3
Plasmid#132304PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorAvailable SinceNov. 11, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCI-TPI_WT-TNFalpha_3UTR-xrRNA-4H
Plasmid#108374PurposeExpresses wild type TPI reporter; contains partial TNFalpha 3' UTR; enables detection of 5'-3' decay intermediates (xrFrag) and allows detection via northern blot (4H binding sites)DepositorInsertUseTagsExpressionMammalianMutationPromoterCMVAvailable SinceJune 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONOR-PARK6e5-I368N
Plasmid#86154PurposeDonor plasmid for PARK6 exon5 I368N sequence. Also contains TagBFP and dTomatoDepositorInsertPINK1 exon 5 homology arms (PINK1 Human)
UseTagsExpressionBacterial and MammalianMutationPromoterAvailable SinceJune 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCI-TPI_WT-RAB7A_3UTR-xrRNA-4H
Plasmid#108372PurposeExpresses wild type TPI reporter; contains partial RAB7A control 3' UTR; enables detection of 5'-3' decay intermediates (xrFrag) and allows detection via northern blot (4H binding sites)DepositorInsertUseTagsExpressionMammalianMutationPromoterCMVAvailable SinceMay 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLuc-Optop38i-dsm
Plasmid#89748PurposeExpression of light-regulated p38 inhibitor, firefly luciferase-fused, dark-state mutant photosensor (AsLov2Ja.C450A), inhibitor MK3BD3-13FDepositorInsertOptop38i dark-state mutant
UseLuciferaseTagsFirefly luciferaseExpressionMammalianMutationC450A mutation of AsLov2JalphaPromoterCMVAvailable SinceAug. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
si:ch211-221n23.1_R (OZ604)
Plasmid#35244DepositorInsertZinc finger array targeting si:ch211-221n23.1 (si:ch211-221n23.1 Zebrafish)
UseZebrafish targetingTagsExpressionMutationPromoterAvailable SinceMarch 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
si:ch211-221n23.1_L (OZ603)
Plasmid#35243DepositorInsertZinc finger array targeting si:ch211-221n23.1 (si:ch211-221n23.1 Zebrafish)
UseZebrafish targetingTagsExpressionMutationPromoterAvailable SinceMarch 5, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEMS1486
Plasmid#29237PurposePleiades (Ple) MiniPromoter expression pattern described in de Leeuw et al., MTM, 2014 (PMID: 24761428).DepositorInsertPle16 (C8orf46 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSExpressionMutationPromoterAvailable SinceNov. 7, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLenti CMV Hygro DHFR.dn-cHSF1
Plasmid#134731PurposeLentiviral expression vector for constitutively active dominant-negative HSF1 fused to DHFR destabilized domainDepositorInsertDHFR.dn-cHSF1 (HSF1 Human)
UseLentiviralTagsDHFRExpressionMammalianMutationDeletion of amino acids 186-202, 379−529PromoterCMVAvailable SinceAvailabilityAcademic Institutions and Nonprofits only -
EF1a-L274GMmMetRS-T2A-mCherry
Plasmid#220800PurposeLentivirus expressing mutant tRNA synthetase for incorporation of noncanonical amino acids in nascent proteins plus mCherry reporter and puro resistanceDepositorInsertMars1 (Mars1 Mouse)
UseLentiviralTags2xFLAG and T2A-mCherryExpressionMutationmutation in MetRS to change aa 274 from L to GPromoterEF1aAvailable SinceJune 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SPNS1_STOP
Plasmid#161439PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-CLN3_STOP
Plasmid#161034PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
CMV-LAMP1-HaloTag
Plasmid#164209PurposeExpresses HaloTag tagged LAMP1 under CMV promoterDepositorAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3ExpressionMutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…PromoterAvailable SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDisplay-iSeroSnFR
Plasmid#128484PurposeFluorescent reporter for serotonin (mammalian expression, membrane localization tag)DepositorInsertiSeroSnFR
UseTagsIg-kappa leader, Myc, PDGFR + enhanced ER export,…ExpressionMammalianMutationPromoterCMVAvailable SinceJan. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-FLT3-D835Y-V5/HIS
Plasmid#236007Purposeexpression of the D835Y kinase defective mutant variant of human FLT3 that is associated with Acute Myeloid Leukemia and Acute Lymphoblastic LeukemiaDepositorInserthuman FLT3-D835Y receptor tyrosine kinase, full length (FLT3 Human)
UseTagsV5/HisExpressionMammalianMutationD835Y substitutionPromoterCMVAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_MFSD14A
Plasmid#131869PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorAvailable SinceOct. 9, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-MFSD14A_STOP
Plasmid#161035PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAS_4xhyb PylT A41AA C55A CRFR1 95TAG 263TAA-HA
Plasmid#154781Purposeplasmid with 4xhybrid PylT cassette (mutant A41AA C55A) and rat CRFR1 95TAG 263TAA, for transient transfection or stable, piggybac-mediated, integrationDepositorInsertCRFR1 (Crhr1 Rat)
UseTagsHAExpressionMammalianMutation95TAG 263TAA in CRFR1-HA, hybrid PylT with A41AA …PromoterEF1Available SinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xhyb PylT A41AA C55A CRFR1 95TAA 263TAG-HA
Plasmid#154780Purposeplasmid with 4xhybrid PylT cassette (mutant A41AA C55A) and rat CRFR1 95TAA 263TAG, for transient transfection or stable, piggybac-mediated, integrationDepositorInsertCRFR1 (Crhr1 Rat)
UseTagsHAExpressionMammalianMutation95TAA 263TAG in CRFR1-HA, hybrid PylT with A41AA …PromoterEF1Available SinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
PiggyBac-TetO-En1-t2a-Foxa2-hygro
Plasmid#176483PurposeTetO-En1-t2a-Foxa2 in a PiggyBac vector with hygromycin resistanceDepositorAvailable SinceApril 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON mCherry-Jph3 WPRE
Plasmid#236237PurposeAAV expression of human Junctophilin3 N-terminally tagged with mCherryDepositorInsertJunctophilin 3 (JPH3 Human)
UseAAVTagsmCherryExpressionMutationPromoterhuman Synapsin 1Available SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-GCaMP5G
Plasmid#31788Purposea single-wavelength GCaMP3-based calcium indicator with improved response. Please also see the GCaMP6s/m/f indicators.DepositorInsertGCaMP5G
UseTags6xHis, T7 epitope, and Xpress tagExpressionMammalianMutationPromoterCMVAvailable SinceAug. 22, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7m-Clover-Geminin(1-110)-IRES-mKO2-Cdt(30-120)
Plasmid#83841PurposeFluorescent probe for G1/S transition and M/G1 transitionDepositorUseLentiviralTagsExpressionMammalianMutationPromoterCMVAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only