We narrowed to 24,925 results for: crispr
-
Plasmid#48678PurposeMammalian tdTomato activation reporter for ST1 with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, ST1-PAM, and tdTomato reporter. Compatible with S. thermophilus #1 Cas9
UseCRISPRPromoterSp6Available sinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pUC18-mini-Tn7T-Lac-dCas9 (Ptac)
Plasmid#105234PurposeTn7 integrating plasmid with S. pasteurianus dCas9 expressed from the Ptac promoter for expression in P. putida and P. fluorescensDepositorInsertS. pasteurianus dCas9
UseCRISPR and Synthetic BiologyTagsHAExpressionBacterialMutationD10A, H599AAvailable sinceSept. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-TO-nls-st1dCas9-3nls-3XGFP-nls
Plasmid#64112PurposeExpression of St1 dCas9-3XGFP in mammalian cellsDepositorInsertSt1 dCas9
UseCRISPR and LentiviralTags3XsfGFPExpressionMammalianPromoterCMV-TOAvailable sinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pnsgRNA
Plasmid#172717PurposeDelivery of guide RNA for prime editingDepositorInsertJ23119-gRNA
ExpressionBacterialAvailable sinceSept. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRS159
Plasmid#122378PurposeCRISPRi plasmid for use in Candida albicans. Contains dCas9-Mxi1 and NEUT5L integration site and the sgRNA cloning site (SNR52 promoter, PacI sites, sgRNA tail)DepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable sinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX330-BsaIx2-DD-Cas9
Plasmid#75380PurposeExpresses DD-SpCas9 in mammalian cells and has a cloning site for an sgRNA. The FKBP12 L106P destabilization domain allows for inducible stabilization of Cas9 through the addition of Shield-1DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertDD-SpCas9
UseCRISPRTagsFKBP12 L106P DDExpressionMammalianPromoterCAGAvailable sinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pY014 (pcDNA3.1-hMbCpf1)
Plasmid#69986PurposeExpresses humanized MbCpf1DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthMbCpf1
UseCRISPRTagsNLS-3xHAExpressionMammalianPromoterCMVAvailable sinceOct. 8, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pKDsgRNA-NT
Plasmid#89960PurposeContains arabinose-induced lambda Red and a tet-inducible non-targeting gRNA containing BsmBI sites for cloning.DepositorInsertempty gRNA
ExpressionBacterialPromoterpTetAvailable sinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRH2521
Plasmid#84380PurposeExpression of sgRNA from a imyc promoter (Pimyc)DepositorInsertsgRNA cloning site
UseCRISPRExpressionBacterialAvailable sinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Lenti-sgNT/Cre
Plasmid#66895PurposeExpresses a non-targeting gRNA and Cre-recombinaseDepositorInsertsgNT
UseCRISPR, Cre/Lox, Lentiviral, and Mouse TargetingExpressionMammalianPromoterU6Available sinceAug. 3, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pU6-sgGAL4-1
Plasmid#46915PurposeHuman pSico-based U6 vector containing murine U6 promoter and sgRNA targeting GAL4 UAS promoterDepositorInsertssgGAL4-1
Puromycin resistance and mCherry
UseCRISPR and LentiviralExpressionMammalianPromoterCMV and U6Available sinceOct. 1, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDAC435
Plasmid#195238PurposeMammalian expression of Csm complex from separate promoters; RFP backbone (Used for RNA knockdown)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertFLAG-NLS-Csm1;FLAG-NLS-Csm2; FLAG-NLS-Csm3; FLAG-NLS-Csm4; FLAG-NLS-Csm5; FLAG-NLS-Cas6; crRNA; RFP
ExpressionMammalianAvailable sinceJan. 27, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMCB306
Plasmid#89360PurposesgRNA expression vector with GFP, puromycin resistance, BlpI+BstXI cloning sitesDepositorInsertGFP, puromycin resistance
UseCRISPR and LentiviralExpressionMammalianAvailable sinceApril 13, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEG302-SunTagng-22aa
Plasmid#115345PurposeEncodes a SunTag CRISPR cas9 system that does not contain a guide RNA and therefore, does not target the TET1 catalytic domain to any specific region of the genomeDepositorInsertNOS_TET1CD_2xNLS_1xHA__sfGFP_scFv_UBQ10_INSULATOR_UBQ10_dCAS9_1xHA_3xNLS_10xGCN422aa_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable sinceNov. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCpf1b
Plasmid#122187PurposeBacterial genome editing plasmid with kanamycin resistance marker and using sacB as a counter-selection markerDepositorTypeEmpty backboneUseCRISPRExpressionBacterialAvailable sinceMarch 12, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAdSh.U6.gRNAGFP
Plasmid#58255PurposeU6 promoter-driven single guide RNA complementary to eGFPDepositorInsertU6.gRNAGFP cassette
UseAdenoviral and CRISPRExpressionMammalianAvailable sinceSept. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDonor-tBFP-NLS-Neo
Plasmid#80766PurposeCustomizable donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.DepositorTypeEmpty backboneUseCRISPRTagsTagBFP2-3×NLSExpressionMammalianAvailable sinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLoxP-DHFR-mCherry
Plasmid#70147PurposeExpresses a DHFR-mCherry fusion protein and uses for a CRISPR gene deletionDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserta selectable dihydrofolate reductase-thymidylate synthase marker
UseExpression in toxoplasma gondiiTagsmCherryPromoterDHFR 5' UTRAvailable sinceNov. 16, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AAV:ITR-U6-sgRNA(LacZ)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR
Plasmid#60225PurposeExpresses Cre recombinase and Renilla luciferase from the EFS promoter and one U6-driven sgRNA targeting LacZ. AAV backbone.DepositorInsertssgRNA
Renilla luciferase
Cre recombinase
UseAAV, CRISPR, Cre/Lox, Luciferase, and Mouse Targe…TagsCre-HA and Rluc-P2AExpressionMammalianPromoterEFS and U6Available sinceOct. 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pET-MBP-NLS-Geo_st
Plasmid#87703PurposeExpression plasmid for Cas9 from Geobacillus stearothermophilus with an N-Term MBP and SV40 NLSDepositorInsertGeoCas9
Tags10xHis-MBP-TEVExpressionBacterialAvailable sinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by