We narrowed to 9,308 results for: control
-
Plasmid#161960PurposeMammalian expression of non-targeted inactivated control version of genetically encoded biosensor for (pseudo)hypohalous acids and their derivativesDepositorInsertHypocrates
ExpressionMammalianMutationchanged Cysteine 355 to SerinePromoterCMV, SP6Available SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pB1H2 UV5 Zif268-cons (2-hybrid bait plasmid)
Plasmid#128164PurposeUV5 promoter drives expression of Zif268-consensus peptide fusion. Pair with pGHUC w-ERBIN as a positive control (turns on HIS3/GFP).DepositorInsert10 amino acid glycine/serine linker + ERBIN PDZ consensus ligand (WETWV)
UseSynthetic BiologyTagsFLAG and zif268ExpressionBacterialPromoterUV5Available SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-RasAR(R89L)-NES
Plasmid#205568PurposeRasAR negative-control mutant plasmid. Targeted to cytosol.DepositorInsertRasAR(R89L)-NES (RAF1 Synthetic, Human)
TagsNuclear export signal (NES)ExpressionMammalianMutationArg 89 mutated to Leu in Raf1 RBD region.PromoterCMVAvailable SinceOct. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pIGAhRC
Plasmid#112510Purposehuman Ah receptor and Arnt cDNAs expressed under control of Gal1,10 bidirectional promoterDepositorUseSynthetic BiologyExpressionYeastPromoterGal1,10Available SinceJuly 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CRISPRv2-sgNTC13-hygro
Plasmid#231988PurposeKnockout non-targeting controlDepositorInsertsgRNA with Cas9 and hygromycin resistance
UseCRISPR and LentiviralAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGF1-4eCOL2A1
Plasmid#97210PurposeLentiviral expression of copGFP-T2A-FLuc under control of a COL2A1-based, chondrogenesis-responsive promoterDepositorInsert4 repeats of COL2A1 intronic enhancer (+2126/+2174) upstream of core promoter (-164/+37) (COL2A1 Human)
UseLentiviral and LuciferaseExpressionMammalianPromoterCOL2A1 regulatory elementsAvailable SinceOct. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO-ChRmine-mScarlet-Kv2.1-WPRE
Plasmid#130999PurposeDouble floxed soma-targeted ChRmine-mScarlet under the control of Ef1a promoterDepositorInsertChRmine
UseAAVTagsmScarlet-Kv2.1PromoterEf1aAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO-ChRmine-mScarlet-WPRE
Plasmid#130998PurposeDouble floxed ChRmine-mScarlet under the control of Ef1a promoterDepositorHas ServiceAAV1 and AAV5InsertChRmine
UseAAVTagsmScarletPromoterEf1aAvailable SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCherryGFP-Inframe-noFSE
Plasmid#177619PurposeDual fluorescent protein reporter for SARS-CoV-2 programmed -1 ribosomal frameshifting. No FSE was inserted. mCherry and GFP are expressed equally (positive control).DepositorInsertNone
UseLentiviralExpressionMammalianAvailable SinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2_mSTING_scrambled_gRNA_1
Plasmid#196627PurposeScrambled control 1 for STING knock-out in murine cells.DepositorInsertmSTING scrambled gRNA 1
UseCRISPR and LentiviralMutationWTAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CRISPRv2-sgNTC49-puro
Plasmid#231989PurposeKnockout non-targeting controlDepositorInsertsgRNA with Cas9 and hygromycin resistance
UseCRISPR and LentiviralAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti NL
Plasmid#113450PurposeLentiviral NanoLuc control expression vectorDepositorInsertNanoLuc
UseLentiviral and LuciferaseTagscmycExpressionMammalianPromoterhUbCAvailable SinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLgw V5-EcoDam
Plasmid#59210PurposeMammalian DamID control lentiviral vector for expression of V5-Dam onlyDepositorInsertEcoDam
UseLentiviral; DamidTagsV5ExpressionMammalianPromoterHeat Shock Minimal Promoter and heat shock minima…Available SinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJM656
Plasmid#53086PurposeA non-Phosphatidylserine binding mutant form of Lactadherin(sGFP::LactC1C2mut) to be used as a controlDepositorInsertLactaherin (Mfge8 Mouse)
TagsGFP (w/ introns) and signal sequenceExpressionWormMutationdeleted native signal sequence, deleted C-termina…Promoterhsp-16.41Available SinceJune 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
CAG FLEX BARK D110A p2A mCherry
Plasmid#117694PurposeCAG-FLEx-iBARK(D110A)-p2A-mCherry: Negative control viral expression vector for Cre-dependent Gaq silencingDepositorInsertBARKrgs D110A peptide
UseCre/LoxTagsHA / FLAGMutationD110AAvailable SinceMay 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOD2044-intDEG
Plasmid#89366PurposeMosSCI targeting vector expressing a fusion between a GFP nanobody and an ubiquitin ligase adaptor ZIF-1 to degrade GFP tagged proteins. Expression is controlled by Pelt-2 (intestine specific).DepositorInsertvhhGFP4-ZIF-1 (zif-1 Nematode, Synthetic)
UseTargeting vector for mos1 transposon mediated sin…TagsvhhGFP4 (GFP nanobody)PromoterPelt-2Available SinceJune 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-ChRmine-mScarlet-Kv2.1-WPRE
Plasmid#130995PurposeAAV vector to drive the expression of soma-targeted ChRmine-mScarlet under the control of human synapsin promoterDepositorHas ServiceAAV8InsertChRmine
UseAAVTagsmScarlet-Kv2.1PromoterhSynAvailable SinceSept. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEcNucC
Plasmid#214050PurposeBacterial expression plasmid for E. coli MS 115-1 NucC, a cA3-responsive nuclease known to cause abortive infection; used as a positive control in the Haliangium ochraceum type III CRISPR-Cas systemDepositorInsertEcNucC
ExpressionBacterialMutationWTPromoterlacUV5 promoterAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO ChRmine-eYFP-WPRE
Plasmid#130996PurposeDouble floxed ChRmine-eYFP under the control of Ef1a promoterDepositorInsertChRmine
UseAAVTagseYFPPromoterEf1aAvailable SinceSept. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-mitoGFP-DIO
Plasmid#174112PurposeCre-dependent expression of mitochondria-targeted Green Fluorescent Protein under control of the EF1a promoterDepositorHas ServiceAAV2InsertmitoGFP (COX8A Human)
UseAAVTagsCox8 targeting sequence and GFPPromoterEf1aAvailable SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
Pomc-pGL3
Plasmid#17553PurposeLuciferase expression under control of Pomc promoter (–646 to +65).DepositorAvailable SinceOct. 17, 2008AvailabilityAcademic Institutions and Nonprofits only -
pBait-YY1
Plasmid#165147PurposeBait plasmid for PROBER with YY1-binding site (positive control)DepositorInsert3X YY1 motif
UseUnspecifiedAvailable SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJFRC-13XLexAoP-FRT-STOP-FRT-myrGFP-2A-KDR::Pest
Plasmid#217515PurposeEncodes a LexAoP controlled and Flp dependent conditional trangene of bicistronic myrGFP and KD RecombinaseDepositorInsert13XLexAoP-FRT-STOP-FRT-myrGFP-2A-KDR::Pest
ExpressionInsectAvailable SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.SV40.Thbs1-HA.SV40(polyA)
Plasmid#195552PurposeExpresses Thbs1 under control of short GFAP promoterDepositorAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-ExRai-AKAR2(T/A)
Plasmid#161754PurposeNegative-control mutant for ExRai-AKAR2 biosensor.DepositorInsertExRai-AKAR2(T/A)
ExpressionMammalianMutationContains Thr-to-Ala mutation in substrate sequenc…PromoterCMVAvailable SinceNov. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTet-O-ASCL1-T2A-PuroR
Plasmid#162345PurposeLentiviral expression of ASCL1 under the control of the TetON promoterDepositorAvailable SinceFeb. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-Nsp16-HF
Plasmid#157725Purposemammalian expression of C-terminally His8-Flag tagged SARS-CoV-2 Nsp16 under control of a tetracycline-inducible promoterDepositorAvailable SinceAug. 6, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMSCV(gfp)U6sgRNA5(BbsI)-PGKpuroBFP
Plasmid#102798PurposeRetrovirus for delivery of one sgRNA (self-targeting) - GFP-targeting control plasmid contains GFP instead of PuroRDepositorInsertssgRNA
EGFP
UseCRISPR and RetroviralExpressionMammalianMutationH231LAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-ChRmine-mScarlet-Kv2.1-WPRE
Plasmid#130991PurposeAAV vector to drive the expression of soma-targeted ChRmine-mScarlet under the control of CamKIIa promoterDepositorHas ServiceAAV8InsertChRmine
UseAAVTagsmScarlet-Kv2.1PromoterCaMKIIaAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
6xHsa.NFKB:d2EGFP
Plasmid#239990PurposeDestabilized green fluorescent protein (d2EGFP) under transcriptional control of NF-kB activityDepositorInsertDestabilized EGFP
Promotercfos minimal promoterAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-fDIO-tdTomato
Plasmid#128434PurposeExpresses tdTomato under control of eukaryotic Ef1a promoter after Flp-dependent recombinationDepositorHas ServiceAAV1InserttdTomato
UseAAVExpressionMammalianPromoterEf1aAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
GfaABC1D BARK D110A p2A mCherry
Plasmid#117692PurposeGfaABC1D-iBARK(D110A)-p2A-mCherry: Negative control viral expression vector for astrocyte Gaq silencingDepositorInsertBARKrgs D110A peptide
UseAAVTagsHA / FLAGMutationD110AAvailable SinceMay 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTet-O-ATOH1-T2A-PuroR
Plasmid#162342PurposeLentiviral expression of ATOH1 under the control of the TetON promoterDepositorAvailable SinceFeb. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-Cepheid1s-ST-WPRE
Plasmid#214968PurposeRed fluorescent, negative response-polarity voltage indicator under the control of synapsin promoter; soma-targeted; for better photostabilityDepositorInsertCepheid1s-ST
UseAAVPromoterhuman SynapsinAvailable SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro_CMV_NES-Caprola_on-mEGFP
Plasmid#194694PurposeCMV driven expression of the consitutively active calcium recorder positive control Caprola_on fused to mEGFP for neuronal expression through lentivirus transductionDepositorInsertCaprola_on-mEGFP
UseLentiviralTagsmEGFPPromoterCMVAvailable SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro_CMV_NES-Caprola_off-mEGFP
Plasmid#194695PurposeCMV driven expression of the inactive calcium recorder negative control Caprola_off fused to mEGFP for neuronal expression through lentivirus transductionDepositorInsertCaprola_off-mEGFP
UseLentiviralTagsmEGFPPromoterCMVAvailable SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-GCaMP 6m-p2A-ChRmine-Kv2.1-WPRE
Plasmid#131003Purposebicistronic AAV vector to express GCaMP6m and soma-targeted ChRmine under the control of CamKIIa promoterDepositorInsertChRmine
UseAAVTagsKv2.1-HAPromoterCaMKIIaAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
LV_EF1a_Ikkalpha(S176E,S180E)-P2A-Hygro_Barcode
Plasmid#170236PurposeBarcoded lentiviral vector to express Ikkalpha (S176E, S180E) in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seqDepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-ChRmine-mScarlet-WPRE
Plasmid#130990PurposeAAV vector to drive the expression of ChRmine-mScarlet under the control of CamKIIa promoterDepositorInsertChRmine
UseAAVTagsmScarletPromoterCaMKIIaAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only