We narrowed to 17,630 results for: URE
-
Plasmid#147494PurposeBacterial Expression of HsNot9DepositorInsertHsNot9 (CNOT9 Human)
ExpressionBacterialAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_SH3GL3-1/1
Plasmid#91423PurposeProtein expression and purification of human SH3 domain construct SH3GL3-1/1DepositorInsertSH3GL3-1/1 (SH3GL3 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
PAK7_HUMAN_D0
Plasmid#79706PurposeThis plasmid encodes the kinase domain of PAK7. Intended for co-expression with Lambda Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
EGFR∆550-580-mEGFP
Plasmid#203788PurposeNumber and brightness analysis of EGFR oligomerizationDepositorAvailable SinceJuly 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_TNK1-1/1-SV1/3
Plasmid#91548PurposeProtein expression and purification of human SH3 domain construct TNK1-1/1-SV1/3DepositorInsertTNK1-1/1-SV1/3 (TNK1 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
MK13_HUMAN_D0
Plasmid#79693PurposeThis plasmid encodes the kinase domain of MK13. Intended for co-expression with Lambda Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorInsertMK13
TagsHis10-TEVExpressionBacterialPromoterT7Available SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET28b(+)-SPN+IFS
Plasmid#83372PurposeExpresses SPN and IFS complex in E. coli cellDepositorInsertsSPN
IFS
TagsHexahistidine tagExpressionBacterialPromoterT7Available SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-cGASΔN-HA (murine)
Plasmid#130915PurposeExpresses murine cGASΔN (aa148-507)-HA; Puromycin selection markerDepositorInsertcGASΔN murine
TagsHAExpressionMammalianMutationmurine cGAS catalytic domain (aa148-507)PromoterCMVAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR221 NLRP1 S1213A
Plasmid#166824PurposeGateway pDONR vector containing NLRP1 with the P1214R patient mutation (no stop codon)DepositorAvailable SinceMarch 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBAD-HisD-mNG-C-Kbp
Plasmid#178013PurposeBacterial expression of green fluorescent potassium indicator mNG-C-KbpDepositorInsertmNG-C-Kbp
ExpressionBacterialPromoteraraBAvailable SinceDec. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBAD-HisD-mNG-Pa-Kbp
Plasmid#178014PurposeBacterial expression of green fluorescent potassium indicator mNG-Pa-KbpDepositorInsertmNG-Pa-Kbp
ExpressionBacterialPromoteraraBAvailable SinceDec. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBAD-HisD-mNG-Hv-Kbp
Plasmid#178015PurposeBacterial expression of green fluorescent potassium indicator mNG-Hv-KbpDepositorInsertmNG-Hv-Kbp
ExpressionBacterialPromoteraraBAvailable SinceDec. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBAD-HisD-mNG-D-Kbp
Plasmid#178012PurposeBacterial expression of green fluorescent potassium indicator mNG-D-KbpDepositorInsertmNG-D-Kbp
ExpressionBacterialPromoteraraBAvailable SinceDec. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
Clim-DC2-NMM-tdtomato
Plasmid#129557PurposepClimDC-NMM:tdT cell membrane markerDepositorInsertN-Myristoylation motif (NMM) fused to tdtomato
ExpressionBacterialAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT TO-EGFP-G3BP1-S149A
Plasmid#136004PurposeDOX-inducible S149A G3BP1 inserted with GFP tagged on the N-terminus and used with the Flp-In T-Rex SystemDepositorAvailable SinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
Myc-Foxo1-WT 6KR
Plasmid#17558DepositorInsertFoxo1 6KR (Foxo1 Mouse)
TagsMycExpressionMammalianMutationK242R, K246R, K259R, K262R, K271R, K291RPromoterCMVAvailable SinceOct. 8, 2008AvailabilityAcademic Institutions and Nonprofits only -
pEBG-MKK4 (GST)
Plasmid#21563DepositorAvailable SinceJuly 17, 2009AvailabilityAcademic Institutions and Nonprofits only -
pJRTCLCrVA010
Plasmid#22843DepositorInsertA DNA containing GFP
UseCotton expression vectorExpressionBacterialMutationCotton Leaf Crumple Virus A component with Coat P…Available SinceJune 14, 2010AvailabilityAcademic Institutions and Nonprofits only -
pOPS0380
Plasmid#133230PurposeReporter plasmid for R. leguminosarum suitable for experiments in environments where there is no antibiotic selection present.DepositorInsertconstructed with constitutive promoter Rlv3841pnifH (pOGG082), mCherry (EC15071) and T-pharma (pOGG003)
ExpressionBacterialMutationDomesticated for Golden Gate cloningAvailable SinceApril 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCellFree_G03 FOXM
Plasmid#67118PurposeStandard for cell-free expression benchmarking.DepositorAvailable SinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pfastbacHTb/mClock26-384
Plasmid#47336PurposemClock fragment cloned into pfastbacHTb vector with Hexa His tagDepositorAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBS-AMV-α1L9'S-nAchR
Plasmid#20684DepositorInsertnicotinic acetylcholine receptors (Chrna1 Mouse)
TagsAMV and pA 50ExpressionBacterialMutationLeucine at 9' position in M2 region changed …Available SinceApril 3, 2009AvailabilityAcademic Institutions and Nonprofits only -
pET30a-SRAP-delCys2
Plasmid#84568PurposeEncodes murine SRAP domain (250aa) of Hmces/Srap1 with deletion of catalytic Cys2DepositorInsertSrap1 (Hmces Mouse)
Tags6xHis and S-TagExpressionBacterialMutationdeletion of Cys2PromoterT7Available SinceNov. 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGEM-PH-citrine
Plasmid#131406PurposePurpose: synthesis of mRNA encoding a membrane marker. Insert: PH domain of the human phospholipase C delta 1 (PLCD1) fused with the yellow fluorescent protein mCitrineDepositorInsertPH
UseIn vitro transcriptionTagscitrine yellow fluorescent proteinPromoterT7Available SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
UKNP.1.12.1
Plasmid#97384PurposeExpression of HCV E1E2 genes cloned from patient serum. United Kingdom Nottingham Panel x.xx.xx (genotype.patient number.clone number)DepositorInsertHCV E1E2
ExpressionMammalianAvailable SinceAug. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pETM41_KEAP1_KELCH
Plasmid#178476PurposeBacterial expression of human domain with His-tag and MBP tagDepositorAvailable SinceMarch 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMS24: pCascade(PmcCAST)_entry
Plasmid#168157PurposeInducible expression of PmcCAST Cascade proteins. Two BsaI sites for spacer cloning.DepositorInsertsPmcCAST minimal CRISPR array
PmcCAST Cascade proteins (Cas6, Cas8, Cas7 and Cas5)
ExpressionBacterialAvailable SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCellFree_G03 GTF2E1
Plasmid#67089PurposeStandard for cell-free expression benchmarking.DepositorAvailable SinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMS6: pHelper(AvCAST)_entry_ΔTnsD
Plasmid#168139PurposeInducible expression of AvCAST proteins (except TnsD). Two BsaI sites for spacer cloning.DepositorInsertsAvCAST minimal CRISPR array
AvCAST Cascade proteins (Cas6, Cas8, Cas7 and Cas5)
AvCAST Tns proteins (TnsA, TnsB, TnsC and TniQ)
ExpressionBacterialAvailable SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCellFree_G03 EBNA1BP2
Plasmid#67072PurposeStandard for cell-free expression benchmarking.DepositorInsertEBNA1BP2 EBNA1BP2 EBNA1 binding protein 2 (EBNA1BP2 Human)
UseCell-free expressionTagsEGFP and HisPromoterT7Available SinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
-962 human cyclin D1 promoter TCF (1)-(4) sites mutant pGL3Basic
Plasmid#32736DepositorInsertCCND1 Promoter (CCND1 Human)
UseLuciferaseMutation-75 TCF(1) and -68 TCF(2) CTTTGATCTTTGCT deletion…Promoter-962 CCND1Available SinceJan. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
VRK3_HUMAN_D0
Plasmid#79681PurposeThis plasmid encodes the kinase domain of VRK3. Intended for co-expression with Lambda Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_SASH3-1/1
Plasmid#91434PurposeProtein expression and purification of human SH3 domain construct SASH3-1/1DepositorInsertSASH3-1/1 (SASH3 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3B-CDS
Plasmid#136045PurposeUPF3B shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (GAAGCCTTGTTCCGATCTAAT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAcrF1
Plasmid#89233PurposePlasmid contains the gene for anti-CRISPR protein AcrF1 (gene 35 from bacteriophage JBD30), with N-terminal 6his tag and TEV protease cleavage siteDepositorInsertAcrF1
Tags6xHis-TEV and FLAGAvailable SinceApril 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKI-cjFOXL2-coemiRFP670-PGK-Puro
Plasmid#186168PurposeKnock-in gene targeting in marmoset cells at FOXL2 locusDepositorInsertemiRFP670
UseMarmoset targetingMutationhuman codon-optimizedAvailable SinceNov. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
ath5:H2B-RFP
Plasmid#105960Purposetransgenesis, appears rather late, likely due to long RFP maturation time but is brighter than most other Ath5 constructDepositorAvailable SinceFeb. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
PHKG2_HUMAN_D0
Plasmid#79736PurposeThis plasmid encodes the kinase domain of PHKG2. Intended for co-expression with Lambda Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
VRK2_HUMAN_D0
Plasmid#79737PurposeThis plasmid encodes the kinase domain of VRK2. Intended for co-expression with Lambda Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2 mir-1-1 reporter hsa-mir-128-1
Plasmid#46675DepositorInserthsa-mir-128-1 (MIR128-1 Human)
UseRNAiTagsV5 and hsa-mir-1-1ExpressionMammalianPromoterCMVAvailable SinceJune 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pT7-V5-SBP-C1-Hs4EBP3_Z
Plasmid#148151PurposeMammalian Expression of Hs4EBP3DepositorInsertHs4EBP3 (EIF4EBP3 Human)
ExpressionMammalianAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSBK.009
Plasmid#187209PurposeExpresses retron Eco1 ncRNA v35 (long a1/a2, barcode 1 [CCT-AGG]), and Cas1 + Cas2DepositorInsertsRetron Eco1 ncRNA v35 (long a1/a2, barcode 1 [CCT-AGG])
Cas1 + Cas2
UseSynthetic BiologyExpressionBacterialPromoterT7/LacAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSL0721 (pDonor_L1-105)
Plasmid#130645PurposeEncodes a mini-transposon derived from V. cholerae Tn6677 CAST, with CmR cargo gene and shortened left end. Total transposon size = 933 bp.DepositorInsertVchCAST donor DNA (short L)
UseCRISPR; TransposonExpressionBacterialAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSL0376 (His-MBP-StrepII-TniQ)
Plasmid#130641PurposeExpresses V. cholerae CAST TniQ from a T7 promoter, with N-terminal His10-MBP-TEVsite-StrepII for purification.DepositorInsertVchTniQ
UseCRISPR; TransposonTagsHis10-MBP-TEVsite-StrepII on TniQExpressionBacterialPromoterT7Available SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEF1α-squirrel-monkey-CHMP3(155)-HA
Plasmid#154173Purposeexpresses squirrel monkey CHMP3(155) in mammalian cellsDepositorInsertCHMP3(155)
TagsHAExpressionMammalianMutationC-terminal truncation of CHMP3 at amino acid 155PromoterEF1-alphaAvailable SinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
DsRed +9e
Plasmid#191766PurposeExpression of DsRed fused to a positively charged polypeptide (2 x KSG) . Overall charge on tetramer: +9eDepositorInsertDsRed
TagsN terminal fusion of positively charged polypetod…ExpressionBacterial and MammalianPromoterCMVAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_SORBS1-1/3
Plasmid#91547PurposeProtein expression and purification of human SH3 domain construct SORBS1-1/3DepositorInsertSORBS1-1/3 (SORBS1 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_SORBS1-3/3
Plasmid#91553PurposeProtein expression and purification of human SH3 domain construct SORBS1-3/3DepositorInsertSORBS1-3/3 (SORBS1 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_SORBS1-2/3
Plasmid#91530PurposeProtein expression and purification of human SH3 domain construct SORBS1-2/3DepositorInsertSORBS1-2/3 (SORBS1 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET15b-ITPA
Plasmid#60824Purposeto purify human ITPA from bacteriaDepositorAvailable SinceMarch 9, 2015AvailabilityAcademic Institutions and Nonprofits only