We narrowed to 11,082 results for: CHL
-
Plasmid#164521PurposeAll-in-One piggyBac transposon Gateway Destination vector for dox-inducible expression of N-terminal His-TEV-GFP tagged protein (inducible NGFR and constitutive rtTA and neomycin resistance)DepositorTypeEmpty backboneExpressionMammalianAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pEW108
Plasmid#232823PurposeExpresses yeast compass complex in insect cellsDepositorInsertTagsHis6-3xFLAG, TwinstrepExpressionInsectMutationSet1(762-1080)Promoterpolyhedrin promoterAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
BAP1 C91A
Plasmid#81025PurposeRetroviral vector containing human BAP1 C91A (catalytically inactive mutant) and Thy1.1 selection markerDepositorInsertBAP1 (BAP1 Human)
UseRetroviralExpressionMammalianMutationBAP1 C91A (point mutation, catalytically inactive)Promoter5’LTRAvailable SinceNov. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pThermoCas9i_ctrl
Plasmid#100982PurposeExpresses the catalytically inactive version of ThermoCas9 (Thermo(d)Cas9) and its sgRNA moduleDepositorInsertsCatalytically inactive variant of the Cas9 from the type IIc CRISPR-Cas sytem of Geobacillus thermodenitrificans T12 strain
ThermoCas9 single guide RNA expressing module
TagsNoneExpressionBacterialMutationchanged aspartate 8 to alanine and histidine 582 …PromoterB. coagulans DSM 1 pta promoter and B. smithii xy…Available SinceNov. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1755 - pcDNA3.1 CMV-IE hChR2(H134R)-V5-ER-LBD (ChRERa)
Plasmid#201819PurposeA plasmid expressing channelrhodopsin-2 fused to a V5 epitope and the ligand-binding domain of estrogen receptor (ChRERa) from a CMV promoterDepositorInserthChR2(H134R)-V5-ER-LBD (ChRERa)
ExpressionMammalianPromoterpOTTC1751Available SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
Cherry-HA-KCC2
Plasmid#104077PurposeTo visualize the expression and localization of potassium-chloride cotransporter type 2 (KCC2)DepositorInsertKCC2 (b isoform) (Slc12a5 Rat)
TagsmCherry-HA tagExpressionMammalianMutationEcoR1 site in rat KCC2 was removed by silent muta…PromoterUbCAvailable SinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC33A1_STOP
Plasmid#161430PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC33A1 (SLC33A1 Human)
ExpressionMammalianAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA3-NES-YFP-CCTc
Plasmid#184328PurposeMammalian expression of the cytosolic localized YFP-CCTd(peptide of Cav1.2)DepositorInsertCCTc (CACNA1C Human)
ExpressionMammalianAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-G6
Plasmid#73437PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant G6.DepositorInsertRepressor G6 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceMarch 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
Rat Alpha2 delta-1 pMT2
Plasmid#58726Purposeexpression of rat alpha2 delta-1 in mammalian cellsDepositorAvailable SinceSept. 23, 2014AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-3A2
Plasmid#73435PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3A2.DepositorInsertRepressor 3A2 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceMarch 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pOTTC292 - pAAV EF1a floxed hChR2(H134R)-EYFP
Plasmid#50834PurposeAn AAV packaging vector that expresses channel rhodopsin 2 (H134R) (fused to EYFP) under the EF1a promoter, which can be deactivated (deleted) by recombination between the flanking loxP sites.DepositorInserthChR2 (H134R)
UseAAV and Cre/LoxTagsEYFPExpressionMammalianMutationH134RPromoterEF1aAvailable SinceOct. 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-4A6
Plasmid#73434PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 4A6.DepositorInsertRepressor 4A6 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-C4
Plasmid#73427PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant C4.DepositorInsertRepressor C4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBABE-hygro-BAP1-G312G-HA
Plasmid#154022PurposeMammalian Expression of HA-tagged BAP1 with the Synonymous Mutation p.G312GDepositorInsertBAP1 (BAP1 Human)
UseRetroviralTagsHemagglutinin (HA)ExpressionMammalianMutationc.936T>G, p.G312G (Synonymous Mutation) by Sit…Available SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
shCCL20
Plasmid#65096Purposeretroviral expression of CCL20 shRNADepositorAvailable SinceJune 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-3F2
Plasmid#73428PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3F2.DepositorInsertRepressor C4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-NES-YFP-CCTd
Plasmid#184326PurposeMammalian expression of the cytosolic localized YFP-CCTd(peptide of Cav1.3)DepositorInsertCCTd (CACNA1D Human)
ExpressionMammalianAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-NLS-YFP-CCTd
Plasmid#184325PurposeMammalian expression of the nuclear localized YFP-CCTd(peptide of Cav1.3)DepositorInsertCCTd (CACNA1D Human)
ExpressionMammalianAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
ku70 insUP+ pXYL-G418-tNOS-pADH2-crtE-tNOS-pXYL-crtI-tNOS-pGPD-crtYB-tNOS+ku70 insD (SBE146)
Plasmid#195048Purposecassette for the deletion of ku70 and overexpression of crtE, crtI, and crtYB under different combination of promotersDepositorInsertscrtE
crtI
crtYB
ExpressionYeastPromoterpADH2, pGPD, and pXYLAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
ku70 insUP+ pXYL-G418-tNOS-pADH2-crtE-tNOS-pGPD-crtI-tNOS-pXYL-crtYB-tNOS+ku70 insD (SBE145)
Plasmid#195047Purposecassette for the deletion of ku70 and overexpression of crtE, crtI, and crtYB under different combination of promotersDepositorInsertscrtE
crtI
crtYB
ExpressionYeastPromoterpADH2, pGPD, and pXYLAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
ku70 insUP+ pXYL-G418-tNOS-pXYL-crtE-tNOS-pGPD-crtI-tNOS-pADH2-crtYB-tNOS+ku70 insD (SBE144)
Plasmid#195046Purposecassette for the deletion of ku70 and overexpression of crtE, crtI, and crtYB under different combination of promotersDepositorInsertscrtE
crtI
crtYB
ExpressionYeastPromoterpADH2, pGPD, and pXYLAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMMACE DEST CMV PE2
Plasmid#206276PurposeDEST vector for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. Encodes PE2 under the control of CMV promoter. CRE-Acceptor in MultiBac system.DepositorInsertPE2
UseCRISPR; Recombinant baculovirus production, multi…ExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-NLS-YFP-CCTc
Plasmid#184327PurposeMammalian expression of the nuclear localized YFP-CCTd(peptide of Cav1.2)DepositorInsertCCTc (CACNA1C Human)
ExpressionMammalianAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
RG6-BAP1_E11
Plasmid#154025PurposeBichromatic Fluorescent Splicing Reporter Minigene for Wild-Type BAP1 Exon 11DepositorInsertBAP1 Exon 11 Fused to DsRed1 and eGFP (BAP1 Human)
UseSplicing reporterTagsDsRed1, FLAG, SV40 NLS, and eGFPExpressionMammalianAvailable SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
RG6-BAP1_E7
Plasmid#154023PurposeBichromatic Fluorescent Splicing Reporter Minigene for Wild-Type BAP1 Exon 7DepositorInsertBAP1 Exon 7 Fused to DsRed1 and eGFP (BAP1 Human)
UseSplicing reporterTagsDsRed1, FLAG, SV40 NLS, and eGFPExpressionMammalianAvailable SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgRNA targeting human SLC12A5 gene stop codon
Plasmid#158577PurposeFor generate double-strand DNA break near the stop codon of the human SLC12A5 gene that encodes neuronal chloride transporter KCC2 protein.DepositorInsertsgRNA targeting human SLC12A5 gene stop codon
UseCRISPRTagsCas9 and GFPExpressionMammalianAvailable SinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-4F2
Plasmid#73431PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 4F2.DepositorInsertRepressor 4F2 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-1B6
Plasmid#73430PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 1B6.DepositorInsertRepressor 1B6 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-3H5
Plasmid#73429PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3H5.DepositorInsertRepressor 3H5 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-1D4
Plasmid#73433PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 1D4.DepositorInsertRepressor 1D4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-1E4
Plasmid#73436PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 1E4.DepositorInsertRepressor 1E4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceMarch 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-5F5
Plasmid#73432PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 5F5.DepositorInsertRepressor 5F5 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBAD-bARGSer-AxeTxe
Plasmid#192473PurposeSecond-generation bacterial acoustic reporter gene derived from SerratiaDepositorInsertsbARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterNative promoter from Enterococcus faecium and pBADAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-GW
Plasmid#60323PurposeThis is a modified version of the pGL4.23 vector from Promega, containing a Gateway cassette upstream of the minimal promoter. This vector can be used for for Gateway cloning of candidate enhancer elements. As negative control, use pGL4.23 without the gateway cassette (available from Promega).DepositorTypeEmpty backboneUseLuciferaseTagsLuciferaseExpressionMammalianAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
plenti-FLAG-CAMK2D
Plasmid#221699PurposeLentiviral expression of FLAG-tagged human CAMK2D in mammalian cellsDepositorInsertCAMK2D (CAMK2D Human)
UseLentiviralAvailable SinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
plenti-FLAG-CAMK2D-ED
Plasmid#221700PurposeLentiviral expression of FLAG-tagged human CAMK2D (K43R/D136N) in mammalian cellsDepositorAvailable SinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNeg-Ma-barnase-TAG3-TAG45
Plasmid#197572PurposeNegative selection plasmid for selecting ncAA-encoding Methanomethylophilus alvus Pyl-RS mutants. Expresses 2xTAG-codon interrupted barnase gene and M. alvus Pyl-tRNA(6). p15a origin of replication.DepositorInsertsBarnase - 2xTAG
M. alvus Pyl-tRNA (6)
TagsnoneExpressionBacterialMutation3TAG and 45TAGPromoteraraC and lppAvailable SinceMarch 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLX304-GW-DCK*-IRES-GFP
Plasmid#176291PurposeGateway vector for use in generating POI-DCK* fusion reporterDepositorInsertMutant Deoxycytidine Kinase (DCK*, S74E R104M D133A) (DCK Human)
UseLentiviralTagsV5ExpressionMammalianMutationS74E R104M D133APromoterCMVAvailable SinceMarch 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV phSyn1-RSR-FLEX-ChR2(H134R)-EYFP-WPRE-bGHpA
Plasmid#65429PurposeCan be used to generate AAV virus that will express the ChR2(H134R)-EYFP channelrhodopsin fusion protein in neurons under intersectional control by Dre and Cre recombinasesDepositorInsertChR2(H134R)-EYFP
UseAAVTagsEYFPMutationH134R variantPromoterhSyn1Available SinceJuly 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-ChR2(H134R)-eYFP
Plasmid#127090PurposeCre-dependent AAV expression of humanized ChR2 (with H134R mutation) fused to eYFP for optogenetic activationDepositorHas ServiceAAV PHP.eBInsertChannelrhodopsin-2
UseAAVTagseYFP (C terminal on insert)ExpressionMammalianMutationHumanized ChR2 gene with histidine 134 changed to…PromoterCAGAvailable SinceJune 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCC1-4k-BBclone2
Plasmid#137070PurposeE. coli plasmid that contains the expression optimized genes for BB0323, P13, DipA and Lmp1DepositorInsertsBB0323
P13
DipA
Lmp1
ExpressionBacterialMutationwild-type, full-length (signal-peptide-containing…Available SinceMay 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLX304-DCK*-GW-IRES-GFP
Plasmid#176289PurposeGateway vector for use in generating DCK*-POI fusion reporterDepositorInsertMutant Deoxycytidine Kinase (DCK*, S74E R104M D133A) (DCK Human)
UseLentiviralTagsV5ExpressionMammalianMutationS74E R104M D133APromoterCMVAvailable SinceMarch 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV phSyn1-FSF-FLEX-ChR2(H134R)-EYFP-WPRE-bGHpA
Plasmid#65454PurposeCan be used to generate AAV virus that will express the ChR2(H134R)-EYFP channelrhodopsin fusion protein in neurons under intersectional control by Flp and Cre recombinasesDepositorInsertChR2(H134R)-EYFP
UseAAVTagsEYFPMutationH134R variantPromoterhSyn1Available SinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pOTTC468 - pAAV EF1a DIO hChR2(H134R)-iRFP
Plasmid#47633PurposeAn AAV vector that expresses channel rhodopsin 2 (H134R) (fused to iRFP) in a Cre-dependent manner (DIO, double floxed inverted open reading frame).DepositorInserthChR2 (H134R)
UseAAV and Cre/LoxTagsiRFPExpressionMammalianMutationH134RPromoterEF1aAvailable SinceSept. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_BAP1_WT
Plasmid#81852PurposeGateway Donor vector containing BAP1 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBIG2abc_nsp12-His6-3xFlag/nsp7/nsp8 (SARS-CoV-2)
Plasmid#169185PurposeBaculoviral transfer vector to co-express nsp12-His6-3xFlag, nsp7 and nsp8 (SARS-CoV-2) in insect cellsDepositorInsertnsp12-His6-3xFlag/nsp7/nsp8 (ORF1ab SARS-CoV-2, Synthetic)
TagsHis6-3xFlag (nsp12 C-terminus)ExpressionInsectMutationCodon optimised for insect cells (Spodoptera frug…PromoterPolyhedrinAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
Spike Display_Part 2 Spacer
Plasmid#172730PurposeEncodes Part 2 of HexaPro-D614G spike to be used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
UseSynthetic BiologyMutationEctodomain only (AAs 1-1208); 682-685 (furin site…Available SinceAug. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits