We narrowed to 7,568 results for: tet on
-
Plasmid#60756PurposeContains PIq driving expression LacI-T, the Lactose inducible chimera with the TAN DBD.DepositorInsertLacI-T
UseSynthetic BiologyExpressionBacterialMutationLacI without the tetramerization domain and the T…Available SinceJune 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFAB1907
Plasmid#47857PurposeBIOFAB reporter plasmid for measuring BBa_B1006 U10 termination efficiencyDepositorInsertBBa_B1006 U10
UseSynthetic BiologyExpressionBacterialMutationAdded two extra U at the end of Bba_1006 poly-U t…PromoterpLTetO12Available SinceDec. 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFAB801
Plasmid#47846PurposeBIOFAB reporter plasmid for measuring trp_att_L126 termination efficiencyDepositorInserttrp_att_L126 terminator
UseSynthetic BiologyExpressionBacterialMutationLoop mutation in trp TerminatorPromoterpLTetO1Available SinceAug. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
CMV-sgE1TSS-short-3'box
Plasmid#92165PurposesgRNA expression vector for Evx1as RNA tethering assayDepositorInsertEvx1as short isoform
UseCRISPRPromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pLV_TRET_hNgn2_UBC_Puro
Plasmid#61474Purpose3rd generation lentiviral vector; TetON promoter driving human Ngn2; constitutive expression of Puromycin selection markerDepositorInsertsUseLentiviralAvailable SinceFeb. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
integrin alpha9 pcDNA1 neo
Plasmid#13585DepositorInsertintegrin alpha 9 (ITGA9 Human)
ExpressionMammalianAvailable SinceJan. 8, 2007AvailabilityAcademic Institutions and Nonprofits only -
qMaLioffG
Plasmid#212825Purposegreen fluorescent FLIM indicator for endogenous ATP imagingDepositorInsertqMaLioffG
ExpressionMammalianPromoterCMVAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
lenti sgRNA(MS2)_zeo backbone
Plasmid#61427Purpose3rd generation lenti sgRNA cloning backbone with MS2 loops at tetraloop and stemloop 2 and EF1a-zeo resistance marker. Contains BsmBI sites for insertion of spacer sequences.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 and EF1AAvailable SinceDec. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCS2-UTX-F-MT2
Plasmid#40619PurposeExpression of enzyme-dead UTX in mammalian cellsDepositorInsertUTX (KDM6A Human)
Tags6xMyc and FlagExpressionMammalianMutationchanged Histidine 1146 and Glutamic Acid 1148 to …PromoterCMVAvailable SinceNov. 5, 2012AvailabilityAcademic Institutions and Nonprofits only -
lenti sgRNA(MS2)_puro backbone
Plasmid#73795Purpose3rd generation lenti sgRNA cloning backbone with MS2 loops at tetraloop and stemloop 2 and EF1a-puro resistance marker. Contains BsmBI sites for insertion of spacer sequences.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 and EF1AAvailable SinceMarch 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
lenti sgRNA(MS2)_puro optimized backbone
Plasmid#73797Purposeoptimized lenti sgRNA cloning backbone with MS2 loops at tetraloop and stemloop 2 and EF1a-puro resistance marker. Contains BsmBI sites for insertion of spacer sequences.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 and EF1AAvailable SinceMarch 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pB-TAG-NICD
Plasmid#130934PurposePiggyBac vector for DOX-inducible human NICD-IRES-EGFP expression in mammalian cellsDepositorAvailable SinceOct. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pINTO-NFH::hSNRNP70
Plasmid#65926PurposeExpression of human SNRNP70 fused to Flag-HA tag (N-terminus)DepositorInsertsmall nuclear ribonucleoprotein 70kDa (U1) (SNRNP70 Human)
TagsFLAG-HAExpressionMammalianMutationTwo silent mutationsPromoterCMV/TO and CMV/TetO2 (T-REx)Available SinceJuly 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mGFAP-Lck-PinkFlamindo
Plasmid#228394PurposeAAV vector to express the red cAMP indicator in astrocytesDepositorInsertPink Flamindo
UseAAVPromotermGFAPAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
lentiSAM v2 (Puro)
Plasmid#92062PurposeModified version of lentiSAM v2, a lenti sgRNA cloning backbone with MS2 loops at tetraloop/stemloop 2, dCas9-VP64, and puro resistance marker. Contains BsmBI sites for insertion of spacer sequences.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 (sgRNA) and EF1a (dCas9-VP64)Available SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1658-dCas9-EGFP
Plasmid#51023PurposeTemplate for NLS-dCas9-NLS-EGFP fusion protein for CRISPR imaging (the recipient vector can be TetON 3G promoter system)DepositorInsertdCas9 fuse to EGFP
UseCRISPR and RetroviralTagsEGFPExpressionMammalianPromoterMSCV LTR promoterAvailable SinceFeb. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
Hygro-Cas9 donor
Plasmid#86883PurposeDonor vector for genomic targeting of a Tetracycline-inducible Cas9 cassette to the human AAVS1/PPP1R12C locus with hygromycin selectionDepositorInserthSpCas9
UseCRISPRTags3xFlag, Nucleoplasmin NLS, and SV40 NLSExpressionMammalianAvailable SinceMarch 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO-HRASG12V
Plasmid#216509PurposeExpresses HRAS with a G12V point mutation in human cells under a tetracycline/doxycycline-inducible promoterDepositorAvailable SinceApril 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5 TEX264wt-cGFP
Plasmid#220211PurposeMammalian expression of wild type TEX264 fused at C-terminus to GFPDepositorAvailable SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
FUW-Sox10
Plasmid#36978DepositorAvailable SinceJuly 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
GfaABC1D-DIO-Lck-mCherry-ibARK-4x6T
Plasmid#241243PurposeCre-dependent expression plasma membrane-tethered ibARK with higher specificity in astrocytesDepositorInsertDIO-Lck-mCherry-ibARK-4x6T
UseAAVAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCI-TPI_WT-4MS2-xrRNA-4H
Plasmid#108371PurposeExpresses wild type TPI reporter; enables detection of 5'-3' decay intermediates (xrFrag); 4MS2 tethering sites upstream of xrRNA and allows detection via northern blot (4H binding sites)DepositorInsertWild type TPI reporter with 4MS2 binding sites upstream of MVE xrRNA and 4H probe binding sites (TPI1 Human)
ExpressionMammalianPromoterCMVAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1_Cre
Plasmid#201198PurposeAAV vector for cre expression under EF1 promoterDepositorInsertscre
EF1alpha promoter
UseAAVExpressionBacterial and MammalianMutationnuclear targeting crePromoterN/A and hEF1alpha promoterAvailable SinceJuly 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTCas9_scr
Plasmid#207566PurposeThermoCas9-mediated cleavage of genomic DNA in E. coliDepositorInsertPlac/tet_ThermoCas9_PlacI_lacI_PJ23119_sgRNA(scrambled non-targeting spacer)
ExpressionBacterialMutationWild-typeAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAVTRE3_Clover
Plasmid#135179PurposeAAV expression of TRE(TRE3G)-driven, Clover expression for fluorescent lablingDepositorInsertsClover
TRE3G
UseAAVExpressionMammalianMutationa variant of GFPPromoterTRE3GAvailable SinceJan. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
hCathepsin S
Plasmid#11251PurposeMammalian expression of human Cathepsin SDepositorAvailable SinceAug. 4, 2006AvailabilityIndustry, Academic Institutions, and Nonprofits -
pYPQ131-STU-Lb
Plasmid#138096PurposeGolden Gate entry vector for 1st crRNA cloning with LbCas12a crRNA scaffold flanked by HH and HDV ribozymesDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ134-STU-Lb
Plasmid#138105PurposeGolden Gate entry vector for 4th crRNA cloning with LbCas12a crRNA scaffold flanked by HH and HDV ribozymesDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only