173,273 results
-
Plasmid#80082PurposeAn improved agroinfection-compatible Tobacco mosaic virus (TMV)-based transient expression vector that lacks the TMV CP gene coding sequence.DepositorTypeEmpty backboneExpressionPlantPromoterCaMV35SAvailable SinceAug. 8, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-hSyn-Mito-HyPerGRt
Plasmid#173198PurposeAAV transfer plasmid for a HyPer7 and tdTomato fusion under hSyn promoterDepositorInsertHyper7-tdTomato
UseAAVPromoterhSynAvailable SinceMarch 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
XLone-PE2
Plasmid#136463PurposeExpresses prime editing 2 (PE2) enzyme upon doxycycline treatmentDepositorInsertPE2
ExpressionMammalianPromoterTRE3GSAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pZR158_Lenti-U6-gRNA-10xCS1-PP7_hPGK-PCP-P65-HSF1-Puro
Plasmid#180273PurposeLentiviral expression vector for CRISPRa-SAM sgRNA with 10x capture sequence, and PCP-P65-HSF1 cassetteDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSPIKE-P
Plasmid#101172Purposechimeric spike resembling V4 region of prokaryotic 16S rRNA to be used in metagenomicsDepositorInsertV4 16S rRNA chimeric spike
UseSynthetic BiologyAvailable SinceOct. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-TRE-MA4-GFP
Plasmid#114380PurposeDoxycycline inducible MLL-AF4 and GFP expression. The construct has been used with CAG-rtTA for making engraftable iPSC derived HSCs.DepositorAvailable SinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDH-CB
Plasmid#72267PurposeExpress gene of interest under CB promoterDepositorTypeEmpty backboneUseLentiviralExpressionMammalianPromoterchicken beta-actin + CMV enhancerAvailable SinceJan. 11, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
L304-EGFP-Tubulin-WT
Plasmid#64060PurposeEGFP fused at the N-terminus of tubulin; lentiviral constructDepositorInserttubulin
UseLentiviralTagsEGFPExpressionMammalianAvailable SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
mScarlet-Rab9a
Plasmid#169074PurposeExpress human Rab9a in mammalian cellsDepositorAvailable SinceJan. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
plex_307-ccdB-hygro
Plasmid#201143PurposepLEX_307 plasmid with hygro markerDepositorTypeEmpty backboneExpressionMammalianPromoterEF-1αAvailable SinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
qTAG-AAVS1-Ef1a-Puro-mScarlet
Plasmid#227274PurposeAAVS1 targeting donor for the insertion of Puro and a strong EF1a promoter expressing mScarlet. To be co-transfected with sgRNA plasmid px330-AAVS1 (Addgene #227272)DepositorInsertAAVS1 Homology Arms flanking a 2A-Puro-EF1a-mScarlet cassette (AAVS1 Synthetic)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSSRB069_pAC8-hsDDB1dB
Plasmid#218790PurposeInsect cell expression vector for 6xHis-TEV-hsDDB1∆BDepositorInsertDNA damage-binding protein 1 (DDB1 Human)
Tags6xHis-TEVExpressionInsectMutationDeleted amino acids 396-705 and replaced with GNG…PromoterpolyhedrinAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(2)
Plasmid#136059PurposeG3BP1 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTATTACACACTGCTGAACC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMSSM24: pCMV-SpuFz1
Plasmid#205260PurposeHuman expression vector for human codon optimized SpuFz1DepositorInsertSpuFz1
ExpressionMammalianAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
p5xATF6-GL3
Plasmid#11976PurposeReporter gene with five ATF6 sites that is highly sensitive to ER stressDepositorInsert5xATF6 binding site
TagsLuc and c-fos promoterExpressionMammalianAvailable SinceAug. 10, 2007AvailabilityAcademic Institutions and Nonprofits only -
pCAD96_hIRG1_4-461_pvp008
Plasmid#124874PurposeExpresses hCAD Asn152Ser mutant in E.coliDepositorInsertcis-aconitate decarboxylase (ACOD1 Human)
TagsStrepTag and TEV siteExpressionBacterialMutationmutated Asn152 to Ser, deleted amino acids 1-3 an…PromoterT7Available SinceOct. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAG roGFP2-mito
Plasmid#168509PurposeExpression of mito-roGFP2 (mitochondrial matrix targeted roGFP2) used for monitoring dynamcs of mitochondrial Redox potentialDepositorInsertmito-roGFP2
TagsroGFP2ExpressionMammalianPromoterCAGAvailable SinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
TFORF1335
Plasmid#142786PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET-45b(+)-Tn5
Plasmid#112112PurposeExpresses hyperactive Tn5 transposase for next generation sequencing library preparationDepositorInsertTn5
TagsHis6ExpressionBacterialMutationE54K E110K P242A L372PAvailable SinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJR101
Plasmid#187241PurposeLentiviral sgRNA vector for Perturb-seq with mU6 sgRNA promoter, CR1 constant region with CS1 capture sequence in stem loop, and UCOE EF1alpha driving PURO-GFP marker expressionDepositorInsertLentiviral sgRNA vector for Perturb-seq with mU6 promoter
UseLentiviralAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-NR2B
Plasmid#17925DepositorAvailable SinceJune 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
pMCRi
Plasmid#207524PurposePlasmid for CRISPRi; oriV(pRO1600/ColE1), xylS (cured of BsaI-sites), Pm→ Sp dCas9, PEM7 →sgRNA; SmR/SpRDepositorInsertxylS (cured of BsaI-sites), Pm→ Sp dCas9, PEM7 →sgRNA; SmR/SpR
UsePseudomonas vectorAvailable SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
LifeAct-GFP-Fis1
Plasmid#182576PurposeExpresses LifeAct-GFP targeted to the outer mitochondrial membrane via the Fis1 tail anchor sequenceDepositorInsertLifeAct-GFP-Fis1
TagsFis1 and LifeActExpressionMammalianAvailable SinceApril 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPB-TRE-ECC-Biosensor
Plasmid#140833PurposeEncoding the TRE promoter based eccDNA biosensorDepositorInsertTRE-ECC Biosensor
UsePiggybac (pb) transposonExpressionMammalianPromoterinverseAvailable SinceJune 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSP2-48-merTetO-EFS-BLaR
Plasmid#118712PurposeContains an optimized 48-mer TetO repeat for imaging of desired lociDepositorInsertsBlasticidin resistance gene
EFS-NS promoter
ExpressionMammalianPromoterEFS-NSAvailable SinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEP4 E02S ET2K
Plasmid#20927Purposeused in the derivation of human iPS cells using non-integrating episomal vectors; expresses Oct4 and Sox2; SV40LT and Klf4DepositorArticleAvailable SinceMay 20, 2009AvailabilityAcademic Institutions and Nonprofits only -
-
pAAV-GfaABC1D-GRAB_g5-HT3.0
Plasmid#208727PurposeExpresses the green 5-HT sensor GRAB_g5-HT3.0 in astrocytesDepositorInsertGreen fluorescent 5-HT sensor GRAB_g5-HT3.0
UseAAVPromoterGfaABC1DAvailable SinceOct. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+) Laccase2 MCS Exon Vector
Plasmid#69893PurposeExpression plasmid for expressing circular RNAs of a desired sequence in mammalian cellsDepositorAvailable SinceMarch 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLX317 SLC2A1
Plasmid#193685PurposeConstitutive lentiviral expression of SLC2A1DepositorInsertSLC2A1 (SLC2A1 Human)
UseLentiviralAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Nanoluc-ccdB
Plasmid#87070PurposeMammalian Gateway-compatible expression vector backbone with an N-terminal Nanoluc luciferaseDepositorTypeEmpty backboneTagsNanoluc luciferaseExpressionMammalianAvailable SinceAug. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
AiP12674 - pAAV-AiE0086h-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2674)
Plasmid#230124PurposeAiE0086h is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceNov. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
N-terminal Halo-Ku70
Plasmid#207547PurposeHomologous recombination donor to insert halo tag at the N terminal of the endogenous Ku70 locus.DepositorInsertHaloTag with flanked by human Ku70 locus sequences
TagsHaloTagExpressionMammalianAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
[#GS24 -LV] Syn1-GFP-OMP25
Plasmid#233566PurposeLentiviral construct of mitochondrial localized GFP to be expressed in the donor cells under the Synapsin1 promotorDepositorInserteGFP (eGFP Synthetic, Aequorea victoria)
UseLentiviral and Synthetic BiologyExpressionMammalianAvailable SinceJune 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pC0047-CMV-dPspCas13b-ADAR1DD(E1008Q)
Plasmid#103863PurposedPspCas13b-ADAR1DD(E1008Q) fusion that can be used to selectively edit adenosine to inosine in RNA molecules when used in conjuction with a guide RNADepositorInsertsUseCRISPRExpressionMammalianMutationChanged histidne 133 to alanine and histidine 105…Available SinceNov. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
pNluc-hbb
Plasmid#239753PurposeTemplate for in vitro transcription of nanoluciferase flanked by the human haemoglobin beta 5' and 3' UTRs.DepositorInsertNanoluciferase flanked by human haemoglobin beta 5' and 3' UTRs
UseLuciferasePromoterT7 (included as part of insert)Available SinceJuly 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLHCX-XBP1 mNeonGreen NLS
Plasmid#115971PurposeER-stress sensor - XBP1 splicing fluorescent reporter with mNeonGreen (retroviral vector backbone)DepositorInsertX-box binding protein 1 (XBP1 Synthetic, Human)
UseRetroviralTagsHA tag, c-myc NLS, and mNeonGreenExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
iBE4max YE1 NG CLYBL
Plasmid#174570Purposedoxycycline inducible BE4max YE1 NG expression for human CLYBL locus knock-inDepositorInsertBE3
ExpressionMammalianPromotertet ONAvailable SinceJan. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
CHRM3-Tango
Plasmid#66250PurposeExpression of G protein-coupled receptors for PRESTO-Tango: parallel receptorome expression and screening via transcriptional output, with transcriptional activation following arrestin translocationDepositorAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET22b-His6-UBCH7
Plasmid#212711PurposeBacterial expression of His6-UBCH7DepositorInsertUBCH7
Tags6xHisExpressionBacterialAvailable SinceJan. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
dCas12Max-ABE
Plasmid#195335Purposevector for encoding a human codon-optimized dCas12Max-ABE driven by CBh promoter, guide RNAs compatible with xCas12i driven by hU6, and mCherry driven by CMV promoterDepositorInserthuman codon-optimized dCas12Max-ABE
ExpressionMammalianMutationN243R, E336R, D1049APromoterCBh, CMV, hU6Available SinceMarch 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTK229
Plasmid#71256Purposeluciferase reposter with 229 bp of the HSV TK promoterDepositorInsertThymidine Kinase promoter
UseLuciferaseTagsluciferaseExpressionMammalianPromoterHSV Thymidine KinaseAvailable SinceNov. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGL3-IE1
Plasmid#52894Purposebaculovirus IE-1 promoter driving firefly luciferaseDepositorInsertIE1 promoter
UseLuciferasePromoterbaculovirus IE1Available SinceMay 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(1)
Plasmid#136058PurposeG3BP1 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTAGTCCCCTGCTGGTCGGGC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
mEmerald-WASP1-C-14
Plasmid#54314PurposeLocalization: Cytoskeleton, Excitation: 487, Emission: 509DepositorAvailable SinceJune 16, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
CMV500 empty vector
Plasmid#33348DepositorTypeEmpty backboneTagsFlagExpressionMammalianPromoterCMVAvailable SinceDec. 9, 2011AvailabilityAcademic Institutions and Nonprofits only -
pIVT_hifiDn29-dCas9-P2A-GFP
Plasmid#247168PurposeIn vitro transcription of human codon optimized fusion of hifiDn29-dCas9-P2A-GFPDepositorInserthifiDn29-dCas9-P2A-GFP
UseIn vitro transcriptionTagsSV40 NLSMutationM6I/E70G/A224P/G227V/Q332K/N341K/L393P/D503N/I98V…Promotermutated T7Available SinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
TetO-FUW-Klf4
Plasmid#20322DepositorAvailable SinceFeb. 23, 2009AvailabilityAcademic Institutions and Nonprofits only -