We narrowed to 1,452 results for: tetracycline
-
Plasmid#201025PurposeExpresses SARS-CoV-2 nsp7 under control of a tetracycline-inducible promoter in mammalian.DepositorInsertnon-structural protein 7 (ORF1ab Severe acute respiratory syndrome coronavirus 2, Synthetic)
ExpressionMammalianPromoterCMV-tet-ONAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pVH666
Plasmid#169610PurposeTier-2 vector encoding PTtgO2-driven SEAP-p2A-iRFP670, PmPGK1-driven TtgA and PmPGK1-driven mRuby2 expression (PTtgO2-CMVmin-2-SEAP-p2A-iRFP670-pA::PmPGK1-TtgA-pA::PmPGK1-mRuby2-pA).DepositorInserttetracycline-controlled SEAP and iRFP expression, PPGK-driven TtgA expression cassette and PPGK-driven YPet expression cassette
ExpressionMammalianPromotertetO7-PCMVmin / PPGK / PPGKAvailable SinceJuly 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVH664
Plasmid#169608PurposeTier-2 vector encoding PTetO7-driven SEAP-p2A-iRFP670, PmPGK1-driven rtTA and PmPGK1-driven YPet expression (PTetO7-CMVmin-2-SEAP-p2A-iRFP670-pA::PmPGK1-rtTA-pA::PmPGK1-YPet-pA).DepositorInserttetracycline-controlled SEAP and iRFP expression, PPGK-driven rtTA expression cassette and PPGK-driven YPet expression cassette
ExpressionMammalianPromotertetO7-PCMVmin / PPGK / PPGKAvailable SinceJuly 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVH663
Plasmid#169607PurposeTier-2 vector encoding PTetO7-driven SEAP-p2A-iRFP670, PmPGK1-driven tTA and PmPGK1-driven YPet expression (PTetO7-CMVmin-2-SEAP-p2A-iRFP670-pA::PmPGK1-tTA-pA::PmPGK1-YPet-pA).DepositorInserttetracycline-controlled SEAP and iRFP expression, PPGK-driven tTA expression cassette and PPGK-driven YPet expression cassette
ExpressionMammalianPromotertetO7-PCMVmin / PPGK / PPGKAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMflCT-o4
Plasmid#101313PurposeContains: complete oriC region of M. florum L1 (oriC4 fragment), colE1 rep origin, recoded tetM and cat resistance genes, origin of transfer of RP4 plasmid.DepositorInsertsoriC4 of M. florum strain L1 (rpmH/dnaA and dnaA/dnaN intergenic regions, with dnaA)
cat resistance gene
UseSynthetic BiologyExpressionBacterialAvailable SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMflT-o1
Plasmid#101309PurposeContains: oriC1 fragment of M. florum L1 replication origin (rpmH/dnaA intergenic region), colE1 replication origin, recoded tetM resistance gene, origin of transfer of RP4 plasmid.DepositorInsertoriC1 of M. florum strain L1 (rpmH/dnaA intergenic region)
UseSynthetic BiologyExpressionBacterialAvailable SinceNov. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
C0040 (tetR)_CD
Plasmid#66027PurposeMoClo Basic Part: CDS - Controller protein, tetR repressor (represses pTet, C0040. can be inhibited by tetracyclin or aTc) [C:C0040:D]DepositorInsertTranscription factor
UseSynthetic BiologyAvailable SinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
R0040 (pTet)_AB
Plasmid#66008PurposeMoClo Basic Part: Controllable promoter - pTet - tetR regulated (strong constitutive promoter repressed by tetR, C0040, which can itself be inhibited by tetracycline or aTc) [A:R0040:B]DepositorInsertControllable promoter
UseSynthetic BiologyAvailable SinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
R0040 (pTet)_EB
Plasmid#66009PurposeMoClo Basic Part: Controllable promoter - pTet - tetR regulated (strong constitutive promoter repressed by tetR, C0040, which can itself be inhibited by tetracycline or aTc) [E:R0040:B]DepositorInsertControllable promoter
UseSynthetic BiologyAvailable SinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
R0040 (pTet)_FB
Plasmid#66010PurposeMoClo Basic Part: Controllable promoter - pTet - tetR regulated (strong constitutive promoter repressed by tetR, C0040, which can itself be inhibited by tetracycline or aTc) [F:R0040:B]DepositorInsertControllable promoter
UseSynthetic BiologyAvailable SinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
R0040 (pTet)_GB
Plasmid#66011PurposeMoClo Basic Part: Controllable promoter - pTet - tetR regulated (strong constitutive promoter repressed by tetR, C0040, which can itself be inhibited by tetracycline or aTc) [G:R0040:B]DepositorInsertControllable promoter
UseSynthetic BiologyAvailable SinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
BS-TRP1-TetOff(7repeats)-GFP-Pho8
Plasmid#207011PurposeTet-Off controlled GFP-Pho8 with TRP1 selection. Tetracycline-controlled transactivator (tTA) present on same plasmid.DepositorInsertPho8
TagsGFPExpressionYeastAvailable SinceJune 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-EGFP-NLS-P2AT2A-mCherry-PTS1
Plasmid#87828PurposeHigh-efficient mammalian expression vector for co-expression of EGFP-tagged and mCherry-tagged proteins using P2AT2A. NLS and PTS1 can be replaced by proteins of interest.DepositorInsertsNLS
PTS1
TagsEGFP and mCherryExpressionMammalianPromoterCMV promoter, tetracycline operatorAvailable SinceApril 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSF4 TetCMV ATF4(5'UTR)-SunTag-Renilla-FKBP-Stop-24xMS2v5-CTE-polyA
Plasmid#164615PurposeExpresses ATF4(5'UTR)-SunTag-Renilla mRNA reporter under tetracycline-inducible promoter. SunTag and Renilla luciferase are in frame with the main start codon of ATF4.DepositorInsertRenilla luciferase
Tags24xMS2v5 (3'UTR) and SunTagExpressionBacterial and MammalianPromoterTetCMVAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pQFmcs-2H12.D11-scarREF
Plasmid#221184PurposecdGreen2 expressed from a cumate-inducible promoter in an operon with mScarlet-I (downstream) as a reference FP (Internal Lab ID: UJ11240)DepositorInsertscdGreen2
mScarlet-I
ExpressionBacterialMutationN-terminus changed: starts with MSKKYGEAVIKE ...PromoterNone (same as cdGreen2) and PQ5 (cumate-inducible)Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
Human MAC-1 alpha
Plasmid#8631DepositorInsertMAC-1 alpha (ITGAM Human)
ExpressionMammalianAvailable SinceJan. 5, 2006AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Neo-TRE-CMV-Cre-rtTA
Plasmid#165457PurposeTetracycline inducible CRE expression from AAVS1 locusDepositorInsertCRE
ExpressionMammalianPromoterTight TRE promoterAvailable SinceMarch 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDule-para-aminoPhe
Plasmid#85502PurposePlasmid for incorporating the non-canonical amino acid para-aminoPhe with the Mj pAF synthetase and cognate amber suppressing tRNA in Ecoli.DepositorInsertp-aminoPhe tRNA synthetase and cognate amber suppressing tRNA derived from M. jannaschii Tyrosine synthetase/tRNA system
TagsNoneExpressionBacterialMutationY32T, E107T, D158P, I159L, L162APromoterlpp (constitutive)Available SinceJan. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV-tetO-Tfap2c
Plasmid#70269PurposeLentiviral plasmid for tetracycline/doxycycline dependent expression of murine Tfap2cDepositorInserttranscription factor AP-2, gamma (Tfap2c Mouse)
UseLentiviralExpressionMammalianPromotertetOAvailable SinceNov. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
pcDNA5-EGFP-NLS-P2A-mCherry-PTS1
Plasmid#87803PurposeMammalian expression vector template for co-expression of EGFP-tagged and mCherry-tagged proteins using P2A. NLS and PTS1 can be replaced by proteins of interest.DepositorInsertsNLS
PTS1
TagsEGFP and mCherryExpressionMammalianPromoterCMV promoter, tetracycline operatorAvailable SinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDule-Tet2.0
Plasmid#85496PurposePlasmid for incorporating the non-canonical amino acid Tetrazine 2.0 with the Mj Tet2.0 synthetase and cognate amber suppressing tRNA in Ecoli.DepositorInsertTetrazine2.0 tRNA synthetase and cognate amber suppressing tRNA derived from M. jannaschii Tyrosine synthetase/tRNA system
TagsNoneExpressionBacterialMutationY32G L65Q F108S Q109D D158S L162NPromoterlpp (constitutive)Available SinceJan. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDule-Acd82
Plasmid#174099PurposeAcridone82 tRNA synthetase and cognate amber suppressing tRNA derived from M. barkeri for expression in E.coli.DepositorInsertAcridone 82 tRNA synthetase and tRNA
ExpressionBacterialMutationN311S, C313G, V366A, W382TAvailable SinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO-HRASG12V
Plasmid#216509PurposeExpresses HRAS with a G12V point mutation in human cells under a tetracycline/doxycycline-inducible promoterDepositorAvailable SinceApril 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-Nsp16
Plasmid#157723Purposemammalian expression of untagged SARS-CoV-2 Nsp16 under control of a tetracycline-inducible promoterDepositorAvailable SinceAug. 6, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLIX405-KANK1
Plasmid#121984Purposetetracycline-inducible expression of C-terminal GFP tagged KANK1DepositorAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
phROSA26-Tet-HA-JLP_WT
Plasmid#208770PurposeTetracycline inducible expression vector for HA-tagged wild-type JLP protein (HA-JLP_WT), used as a donor plasmid for HA-JLP_WT knock-in at the human ROSA26 locusDepositorInsertJLP (SPAG9 Human)
ExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBT268_(pCA-ATG-intron-tTA2-iiTRE-tdT3Mycii)
Plasmid#36880DepositorInsertstTA2
tdT-3Myc
insulator
Tags3 Myc tagsExpressionMammalianMutationinsertion of a beta-globin intron with a loxP sit…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available SinceAug. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSlick-Neo-RECK
Plasmid#121986PurposeTetracycline-inducible expression of untagged full-length RECKDepositorAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDule-Mb haloTyrRS C6
Plasmid#160377PurposeC6 HaloTyrosine tRNA synthatase and cognate amber suppressing tRNA derived from M. barkeri.DepositorInsertC6 HaloTyrosine tRNA synthatase
UseSynthetic BiologyExpressionBacterial and MammalianMutationL270S, Y271L, N311G, C313TAvailable SinceNov. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSW002-Pc-TorA(sp)-mTurquoise2
Plasmid#111254PurposeBroad host-range bacterial expression vector with constitutive Pc promoter followed by E. coli TorA signal peptide in frame with mTurquoise2 (codon optimized for P. fluorescens); export to periplasmDepositorInsertTorA(sp)-mTurquoise2
ExpressionBacterialMutationmTurquoise2 is codon optimized for expression in …PromoterPcAvailable SinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
RNF130 shRNA-TRE
Plasmid#225336PurposeshRNAmir backbone under tet-operator for RNA interference, with YFPDepositorInsertRNF130 shRNA (Rnf130 Mouse)
UseAAV and RNAiExpressionMammalianPromoterTRE (tetracycline-responsive element)Available SinceSept. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-Nsp1
Plasmid#157679Purposemammalian expression of untagged SARS-CoV-2 Nsp1 under control of a tetracycline-inducible promoterDepositorAvailable SinceAug. 4, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
integrin beta6 pcDNA1 neo
Plasmid#13580DepositorInsertintegrin beta 6 (ITGB6 Human)
ExpressionMammalianAvailable SinceJan. 8, 2007AvailabilityAcademic Institutions and Nonprofits only -
pCD5-D/bovine/Nebraska/9-5/2012-HEFs57aED-GCN4-sfGFP-ST
Plasmid#175020PurposeExpresses influenza D virus trimeric hemagglutinin esterase fusion protein fused to a sfGFPDepositorInsertD/bovine/Nebraska/9-5/2012
TagsGCN4-TEV-sfGFP-TwinStrepExpressionMammalianMutations57a esterase knock out mutantPromoterCMVAvailable SinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-Nsp13
Plasmid#157712Purposemammalian expression of untagged SARS-CoV-2 Nsp13 under control of a tetracycline-inducible promoterDepositorAvailable SinceAug. 6, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA5-FRT-TO-Nsp9
Plasmid#157703Purposemammalian expression of untagged SARS-CoV-2 Nsp9 under control of a tetracycline-inducible promoterDepositorAvailable SinceAug. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA5-FRT-TO-Nsp10
Plasmid#157706Purposemammalian expression of untagged SARS-CoV-2 Nsp10 under control of a tetracycline-inducible promoterDepositorAvailable SinceAug. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA5-FRT-TO-Nsp12
Plasmid#157709Purposemammalian expression of untagged SARS-CoV-2 Nsp12 under control of a tetracycline-inducible promoterDepositorAvailable SinceAug. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA5-EGFP-NLS-T2A-mCherry-PTS1
Plasmid#87827PurposeMammalian expression vector template for co-expression of EGFP-tagged and mCherry-tagged proteins using T2A. NLS and PTS1 can be replaced by proteins of interest.DepositorInsertsNLS
PTS1
TagsEGFP and mCherryExpressionMammalianPromoterCMV promoter, tetracycline operatorAvailable SinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-Nsp8
Plasmid#157694Purposemammalian expression of untagged SARS-CoV-2 Nsp8 under control of a tetracycline-inducible promoterDepositorAvailable SinceAug. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDule-IBBN (G2)
Plasmid#85500PurposePlasmid for incorporating the non-canonical amino acid IBBN with the Mj IBBN (G2) synthetase and cognate amber suppressing tRNA in Ecoli.DepositorInsertIBBN (G2) synthetase and cognate amber suppressing tRNA derived from M. jannaschii Tyrosine synthetase/tRNA system
ExpressionBacterialMutationY32G L65E F108W Q109M D158S R162KPromoterlpp (constitutive)Available SinceMarch 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-Nsp7
Plasmid#157688Purposemammalian expression of untagged SARS-CoV-2 Nsp7 under control of a tetracycline-inducible promoterDepositorAvailable SinceAug. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA1-Bystin
Plasmid#11869DepositorInsertBystin (BYSL Human)
ExpressionMammalianAvailable SinceSept. 1, 2006AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-Nsp5
Plasmid#157685Purposemammalian expression of untagged SARS-CoV-2 Nsp5 under control of a tetracycline-inducible promoterDepositorAvailable SinceAug. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDN-G1Tt
Plasmid#44509DepositorInsertsUseSynthetic Biology; Expression regulator/reporterExpressionYeastMutationTwo tandem tet operators (2XtetO2) downstream of …PromoterPGal1-D12 promoterAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSL011_AAVS1-puro-9xTetO-pEF-H2B-mCitrine-pRSV-H2B-mCherry
Plasmid#179428PurposeDual fluorescent reporter construct with no spacer, upstream TRE (Tetracycline Response Element) recruitment site, arms for integration at AAVS1 locusDepositorInsertTRE-cit-(nospacer)-mch
ExpressionMammalianPromoterpEF alpha, pRSVAvailable SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBT259_(pRosa26-G-tTA2)
Plasmid#36878DepositorInsertsGFP
tTA2
beta-globin intron
Neo
diphteria toxin A
ExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available SinceAug. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
pBT250_(pCA-G-intron(Neo)-tTA2)
Plasmid#36876DepositorInsertsGFP
tTA2
beta-globin intron
Neo
ExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available SinceAug. 8, 2012AvailabilityAcademic Institutions and Nonprofits only