We narrowed to 21,452 results for: SPR
-
Plasmid#195105PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting downstream of the human CTCF 3'UTR. Puromycin selection (2A-fusion).DepositorInsertsgRNA against CTCF 3' UTR region
UseCRISPRExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA2-CTCF-prom
Plasmid#195104PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting upstream of the human CTCF promoter. Puromycin selection (2A-fusion).DepositorInsertsgRNA against CTCF promoter
UseCRISPRExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-tdTomato targeting vector (compatible with CAGGS-AsCpf1-2A-GFP-U6-AAVS1-sgRNA)
Plasmid#194728PurposeAAVS1-tdTomato targeting vector, compartible with Cpf1DepositorInserttdTomato
UseCRISPR; Knockin targeting plasmidAvailable SinceJan. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
TERTpWT_Gluc_CCR5
Plasmid#192270PurposeDonor template for insertion of hTERT promoter driven Gaussia luciferase reporterDepositorInsertPromoter Reporter Insert within donor template
UseCRISPRPromoterTERT promoter driving expression of gaussiaAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV sgRNA-Notch1 #1 GFP
Plasmid#106950PurposeLentivirus encoding sgRNA targeting murine Notch1. Includes GFP marker.DepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCold I-Hero13
Plasmid#187929PurposeBacterial expression of heat-resistant obscure (Hero) protein Hero13DepositorAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTR-471 IRF4-tNGFR
Plasmid#186061PurposeKnockin of truncated NGFR to target geneDepositorAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTR-472 FOXO1-tNGFR
Plasmid#186062PurposeKnockin of truncated NGFR to target geneDepositorAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgPten#2/Cre
Plasmid#173646PurposeExpresses a Pten-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Pten (Pten Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgEp300#1/Cre
Plasmid#173591PurposeExpresses a Ep300-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Ep300 (Ep300 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgTp53#2/Cre
Plasmid#173621PurposeExpresses a Tp53-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Tp53 (Trp53 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgKmt2d#2/Cre
Plasmid#173598PurposeExpresses a Kmt2d-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Kmt2d (Kmt2d Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9-Puro HLAG-2A-sgRNA
Plasmid#182551PurposeCas9 from S.pyogenes with 2A-Puro, and the 2A-sgRNA to targeting exon 2 of human HLA-G geneDepositorInserthSpCas9-2A-Puro-HLAG-2A-sgRNA
UseCRISPRExpressionMammalianPromoterCbhAvailable SinceMay 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMC234r-ccdB/TPK2
Plasmid#176179Purposeyeast MoClo level-0 part plasmid type 234r containing toxic gene dropout cassette (ccdB and TPK2)DepositorInsertdropout cassette containing toxic genes ccdB and TPK2
UseSynthetic BiologyAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
p2T-CMV-HNHx-ABEmax7.10HD-BlastR
Plasmid#176477PurposeA-to-G base editor with alternative targeting scopeDepositorInsertHNHx-ABEmax7.10HD
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceNov. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDF0044 CjcCas7-11 full locus with synthetic array
Plasmid#172502PurposeEncodes the CjcCas7-11 full locus for bacterial expressionDepositorInsertCjcCas7-11 full locus with synthetic array
ExpressionBacterialAvailable SinceNov. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1-G7
Plasmid#173203PurposeExpresses the ATP1A1 G7 sgRNA in combination with FLAGless eSpCas9(1.1) to target ATP1A1 intron 17. pX330-like plasmid.DepositorInsertATP1A1 G7 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
px458-CCND1
Plasmid#172630PurposeExpresses a gRNA against CCND1 and Cas9 from S. pyogenes with 2A-EGFPDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJCC_058 FnCas12a D917A
Plasmid#171667PurposeFor bacterial expression of FnCas12a D917A (RuvC-inactivating mutation) with a C-terminal sorting motif and His tagDepositorInsertFnCas12a D917A
Tags6X His and sortase A sorting motifExpressionBacterialMutationchanged aspartate 917 to alanineAvailable SinceJuly 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCSN074
Plasmid#166731PurposeSingle copy yeast plasmid expressing DNase-dead dLbCas12a E925A fused to NLS, codon optimized for Saccharomyces cerevisiaeDepositorInsertdCas12a-NLS
UseCRISPRTagsSV40 NLSExpressionYeastMutationE925APromoterS. cerevisiae TEF1Available SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ284-RVR
Plasmid#138117PurposeGateway entry plasmid (attL1 & attR5) expressing rice codon optimized Mb2Cas12a with N563R, K569V and N573R mutations, without promoterDepositorInsertMb2Cas12a RVR variant
UseCRISPR; Gateway compatible cas12a entry cloneTagsNLSExpressionPlantMutationN563R, K569V and N573RAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site2 (RTW448)
Plasmid#160137PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2DepositorInsertSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site4 (MSP3511)
Plasmid#160139PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #4DepositorInsertAsCas12a crRNA with spacer #4 (spacer=GGAATCCCTTCTGCAGCACCTGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLJC6-GPT1-3xFLAG
Plasmid#163448Purposelentiviral overexpression vector for human GPT1DepositorInsertGPT1 (GPT Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationSee: commentsPromoterUbcAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Cacnb4-GFP KI
Plasmid#139663PurposeEndogenous tagging of CaVβ4: C-terminal (amino acid position: H417)DepositorInsertgRNA and GFP donor
ExpressionMammalianPromoterU6 and CbhAvailable SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
p-dCas9-JMJD2A-S288G-T289G-Hygro
Plasmid#104418Purposetransient expression of dCas9-dJMJD2A fusion proteinDepositorInsertdJMJD2A
UseCRISPRExpressionMammalianMutationS288G-T289GPromoterCMV promoterAvailable SinceApril 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
p-dCas9-dTET1-H1672Y-D1674A-Hygro
Plasmid#104413Purposetransient expression of dCas9-dTET1 fusion proteinDepositorInsertdTET1
UseCRISPRExpressionMammalianMutationH1672Y-D1674APromoterCMV promoterAvailable SinceApril 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA17_Efa-NLS(SV40) (KAC91)
Plasmid#134333PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA17_Efa with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA17_Efa
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA16_Efa-NLS(SV40) (KAC459)
Plasmid#134337PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA16_Efa with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA16_Efa
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Puro-sgMARK2
Plasmid#138689PurposeExpresses a human MARK2-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Puro-SIK1
Plasmid#138695PurposeExpresses a human SIK1-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Blast-sgSIK2
Plasmid#138708PurposeExpresses a human SIK2-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Puro-sgMARK3
Plasmid#138690PurposeExpresses a human MARK3-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
CAG-xFNLS-T2A-EGFP-ires-puro
Plasmid#121171PurposeCAG promoter driven expression of xFNLS BE3 base editor, EGFP and Puromycin resistance.DepositorInsertxFNLS-T2A-EGFP-ires-puro
UseCRISPRTagsT2A-EGFP-ires-puroExpressionMammalianAvailable SinceJuly 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP307-pAAV-EFS(No AgeI)-MCS3-pA
Plasmid#113684PurposeEFS driven Multi Cloning Site-3 without the AgeI restriction enzyme site.DepositorInsertN/A
UseAAVPromoterCytomegalo Virus(CMV)Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSPDEF.1.0-gDNA
Plasmid#113796PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor SPDEFDepositorAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pERF.1.0-gDNA
Plasmid#112395PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ERFDepositorAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTEAD1-donor
Plasmid#112329PurposeCRISPR donor plasmid to tag human transcription factor TEAD1 with GFPDepositorInsertTEAD1 homology arms flanking EGFP-IRES-Neo cassette (TEAD1 Human)
UseCRISPRAvailable SinceNov. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pICSL11023
Plasmid#117542PurposeLevel 1 Golden Gate Cassette: Cas9 expression cassette for dicotyledonous plantsDepositorInsert2x35S+5'UTR OMEGA (pICH51288) + SpCas9-h (no stop codon)(pICSL90005) + YFP (pICSL50005)+ Nos (pICH41421)
ExpressionPlantPromoter2x35S_OMEGA(pICH51288)Available SinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -