We narrowed to 17,815 results for: Por
-
Plasmid#253411PurposeExpression in E. coli of a mouse H1 variant fused with His-tagged linear-tetraUb at N-terminus. An additional Cys was inserted between M1 and T2 in H1.DepositorAvailabilityAcademic Institutions and Nonprofits only
-
pDONR221-SLCO1B3_STOP
Plasmid#161366PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLCO1B3 (SLCO1B3 Human)
ExpressionMammalianAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
RG6-BAP1_E11-G312G
Plasmid#154026PurposeBichromatic Fluorescent Splicing Reporter Minigene for Mutant BAP1 Exon 11 c.936T>G, p.G312G (Synonymous Mutation)DepositorInsertBAP1 Exon 11 Fused to DsRed1 and eGFP (BAP1 Human)
UseSplicing reporterTagsDsRed1, FLAG, SV40 NLS, and eGFPExpressionMammalianMutationBAP1 c.936T>G, p.G312GAvailable SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
PB-tetO-NB
Plasmid#197092PurposePiggyBac plasmid with tet-inducible expression of transcription factors for sensory neuron differentiationDepositorAvailable SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC25A4_STOP
Plasmid#161148PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC25A4 (SLC25A4 Human)
ExpressionMammalianAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLenti_SIV-(SalI)-syn-IRES-mEmerald-CaV1.2 WPRE
Plasmid#236241PurposeLentiviral expression of voltage-gated calcium channel, CaV1.2, N-terminally tagged with mEmeraldDepositorAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
EF1a-L274GMmMetRS-T2A-mCherry
Plasmid#220800PurposeLentivirus expressing mutant tRNA synthetase for incorporation of noncanonical amino acids in nascent proteins plus mCherry reporter and puro resistanceDepositorInsertMars1 (Mars1 Mouse)
UseLentiviralTags2xFLAG and T2A-mCherryMutationmutation in MetRS to change aa 274 from L to GPromoterEF1aAvailable SinceJune 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-28a(+)-FGF2-K128N
Plasmid#120284PurposeProduce human recombinant FGF2 K128N in DE3 cellsDepositorInsertBasic fibroblast growth factor 2 (FGF2 Synthetic, Human)
Tags6x HisExpressionBacterialMutationCodon optimized for E. Coli productionPromoterT7 promoterAvailable SinceJune 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPD292 PPH/HBB_IVS2/-T2A-dCas9-NFZ-P2A-BFP
Plasmid#249156PurposeOverexpression of PPH-T2A-dCas9-NFZ-P2A-BFP with HBB IVS2 intron in PPH coding sequence and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertPPH/HBB_IVS2/-T2A-dCas9-NFZ-P2A-mTagBFP2 (HBB S. pyogenes Cas9, synthetic, Human)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-KIF5A-HA-IRES-Puro
Plasmid#166952PurposeLentiviral plasmid expressing HA-tagged KIF5A protein with IRES-Puro from the EF1a promoterDepositorAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-KIF5AR280H-HA-IRES-Puro
Plasmid#166953PurposeLentiviral plasmid expressing HA-tagged KIF5A R280H protein with IRES-Puro from the EF1a promoterDepositorAvailable SinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHDR-FOXL2-T2A-tdTomato-PuroTK
Plasmid#192892PurposeHDR donor for inserting FOXL2-T2A-tdTomato reporterDepositorInsertFOXL2-tdTomato (FOXL2 Human)
UseCRISPRMutationT2A-tdTomato fluorescent reporterPromoterPGKAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-FGFR1c-V5/HIS
Plasmid#201106Purposeexpression of human FGFR1 receptor tyrosine kinase in mammalian cellsDepositorInserthuman FGFR1 receptor tyrosine kinase, variant c, full length, wildtype (FGFR1 Human)
TagsV5/HisExpressionMammalianPromoterCMVAvailable SinceJune 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CMV-LAMP1-HaloTag
Plasmid#164209PurposeExpresses HaloTag tagged LAMP1 under CMV promoterDepositorAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-MFSD2B_STOP
Plasmid#161435PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertMFSD2B (MFSD2B Human)
ExpressionMammalianAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLenti HsATP13A2 WT
Plasmid#171485Purposetransfer plasmid for lentiviral vector production expressing Hs ATP13A2 WTDepositorAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_SLC35F6
Plasmid#132073PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC35F6 (C2orf18 Human)
ExpressionMammalianAvailable SinceNov. 11, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pHR-Fzd4 subtype NGS Wnt
Plasmid#159625PurposeExpress Fzd4 subtype NGS Wnt in mammalian cellsDepositorInsertFzd4 subtype NGS Wnt
UseLentiviralTagsHis tagExpressionMammalianAvailable SinceSept. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKT2/CAGXSP/CD63mScarlet
Plasmid#182972PurposeStably express CD63 fused with mScarlet in mammalian cells via the sleeping beauty transposon system.DepositorAvailable SinceApril 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMIH-TFAM-GFP
Plasmid#113704PurposeFluorescent fusion protein used to visualise mitochondrial nucleoids, with hygromycin selectionDepositorAvailable SinceJan. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF1a-mEmerald-CAPRIN1
Plasmid#164218PurposeExpresses mEmerald tagged CAPRIN1 under EF-1a promoterDepositorAvailable SinceJune 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX-EF1a ANXA11-mEmerald
Plasmid#164210PurposepLEX lentivirus backbone expresses mEmerald tagged ANXA11 under EF1a promoterDepositorAvailable SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON mCherry-Jph3 WPRE
Plasmid#236237PurposeAAV expression of human Junctophilin3 N-terminally tagged with mCherryDepositorAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDisplay-iSeroSnFR
Plasmid#128484PurposeFluorescent reporter for serotonin (mammalian expression, membrane localization tag)DepositorInsertiSeroSnFR
TagsIg-kappa leader, Myc, PDGFR + enhanced ER export,…ExpressionMammalianPromoterCMVAvailable SinceJan. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)_U6 tRNAPyl_CMV NESPylRS(AF)_IRES_eRF1(E55D)-HA
Plasmid#182653PurposeEncodes codon-optimized AF mutant of M. mazei pyrrolysine (Pyl) tRNA synthetase fused to a nuclear export signal (NESPylRSAF),tRNACUAPyl & eRF1E55D used for amber codon suppression in mammalian cellsDepositorInsertscodon-optimized Y306A/Y384F (AF) double mutant of Methanosarcina mazei-derived pyrrolysine (Pyl) tRNA synthetase
PylT
mutant eukaryotic release factor 1
TagsHA tag and nuclear export signal (NES)ExpressionMammalianMutationE55D and Y306A/Y384F (AF) double mutant of Methan…PromoterCMV and U6Available SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCE-K2N
Plasmid#154879PurposeEpisomally expresses KLF2 and NANOG in mammalian cellsDepositorAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCE-KdGl
Plasmid#154880PurposeEpisomally expresses KDM4D and GLIS1 in mammalian cellsDepositorAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-Basigin_iso2
Plasmid#221416PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertBasigin_iso2 (BSG Human)
ExpressionMammalianAvailable SinceJuly 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
IL2Ralpha-pEGFP-FKBP
Plasmid#251430PurposeMammalian expression vector for expressing the human interleukin-2 receptor alpha subunit (IL2Ralpha membrane anchor) fused to EGFP and FKBP at the C-terminusDepositorAvailable SinceMarch 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON mEmerald-Sec61b WPRE
Plasmid#236228PurposeAAV expression of a marker for the endoplasmic reticulum, Sec61b, fused to mEmerald.DepositorAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_SLC29A1
Plasmid#131927PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC29A1 (SLC29A1 Human)
ExpressionMammalianAvailable SinceOct. 16, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-SLC4A11_STOP
Plasmid#161358PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC4A11 (SLC4A11 Human)
ExpressionMammalianAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
PLEX-PGK-LAMP1-HaloTag
Plasmid#164216PurposepLEX lentivirus backbone expresses HaloTag tagged LAMP1 under PGK promoterDepositorAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-Puro-{CMV-CuO}>{PAX3::FOXO1}:T2A:mCherry
Plasmid#236629PurposePuromycin selected lentiviral construct with cumate-inducible PAX3::FOXO1DepositorUseLentiviralExpressionMammalianPromoterCMV-CuOAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-GCaMP5G
Plasmid#31788Purposea single-wavelength GCaMP3-based calcium indicator with improved response. Please also see the GCaMP6s/m/f indicators.DepositorInsertGCaMP5G
Tags6xHis, T7 epitope, and Xpress tagExpressionMammalianPromoterCMVAvailable SinceAug. 22, 2011AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-Basigin
Plasmid#221415PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertBasigin (BSG Human)
ExpressionMammalianAvailable SinceJuly 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-Embigin
Plasmid#221417PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertEmbigin (EMB Human)
ExpressionMammalianAvailable SinceJuly 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBAC-ie1-DsRed-ObirOrco-QF2-15xQUAS-GCaMP6s
Plasmid#200400PurposeExpresses DsRed broadly, expresses QF2 and GCaMP6s in OSNs of the clonal raider antDepositorInsertsDiscosoma red fluorescent protein
Q factor 2
GCaMP6s
ExpressionInsectPromoter15x QUAS, ObirOrco (Oocearaea biroi Orco promoter…Available SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only