We narrowed to 5,993 results for: crispr cas9 expression plasmids
-
Plasmid#192132PurposeExpresses highly specific Hsp1-Hsp2Cas9, cloning backbone for sgRNA and puromycin resistance geneDepositorInsertHsp1-Hsp2Cas9-Y
UseAAVTagsExpressionMammalianMutationHsp1-Hsp2Cas9 (Y446A)PromoterAvailable sinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-ACTB_sgRNA
Plasmid#183884PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and ACTB sgRNA for N-terminal tagging of beta-actin in human cells.DepositorInsertACTB sgRNA spacer (ACTB Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_T2A_mCherry sg1-sg2
Plasmid#192479PurposeAll-in-one plasmid containing both guides for cutting BFP region in DSB Spectrum V1DepositorInsertSpCas9
UseTagsT2A mCherryExpressionMammalianMutationPromoterAvailable sinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-BPNLS-ABE8e(V106W)-SpCas9(D10A)-BPNLS-P2A-EGFP (CA77)
Plasmid#208290PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE8e(V106W) A-to-G base editor with SpCas9(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8e(V106W)-SpCas9-BPNLS-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations and V106W in TadA and nSpCas9(D10…PromoterCMV and T7Available sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8e-nSpCas9-P2A-EGFP (KAC978)
Plasmid#185910PurposepCMV and pT7 plasmid encoding human codon optimized ABE8e A-to-G base editor with nickase SpCas9(D10A) and P2A-EGFPDepositorInserthuman codon optimized ABE8e-nSpCas9-P2A-EGFP
UseIn vitro transcription; t7 promoterTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationnSpCas9=D10APromoterCMV and T7Available sinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8.20m-nSpCas9-P2A-EGFP (KAC1158)
Plasmid#185915PurposepCMV and pT7 plasmid encoding human codon optimized ABE8.20m A-to-G base editor with nickase SpCas9(D10A) and P2A-EGFPDepositorInserthuman codon optimized ABE8.20m-nSpCas9-P2A-EGFP
UseIn vitro transcription; t7 promoterTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationnSpCas9=D10APromoterCMV and T7Available sinceJuly 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-SpCas9_gRNA-OPA1-del_exon5-gRNA1a_(CJT90)
Plasmid#226989PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-del_exon5 cell line via nuclease mediate excision, gRNA 1a must be used with gRNA 2a or 2bDepositorInsertSpCas9 gRNA 1a to create OPA1-del_exon5
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-SpCas9_gRNA-OPA1-del_exon5-gRNA2a_(CJT91)
Plasmid#226991PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-del_exon5 cell line via nuclease mediate excision, gRNA 2a must be used with gRNA 1a or 1bDepositorInsertSpCas9 gRNA 2a to create OPA1-del_exon5
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-SpCas9_gRNA-OPA1-createR194G-A6-gRNA_(CJT88)
Plasmid#226987PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-R194G cell line via adenine base editing (target base in position A6)DepositorInsertSpCas9 gRNA A6 to create OPA1-R194G
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-SpCas9_gRNA-OPA1-createR194G-A7-gRNA_(CJT89)
Plasmid#226986PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-R194G cell line via adenine base editing (target base in position A7)DepositorInsertSpCas9 gRNA A7 to create OPA1-R194G
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-SpCas9_gRNA-OPA1-del_exon5-gRNA2b_(CJT93)
Plasmid#226992PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-del_exon5 cell line via nuclease mediate excision, gRNA 2b must be used with gRNA 1a or 1bDepositorInsertSpCas9 gRNA 2b to create OPA1-del_exon5
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-SpCas9_gRNA-OPA1-del_exon5-gRNA1b_(CJT92)
Plasmid#226990PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-del_exon5 cell line via nuclease mediate excision, gRNA 1b must be used with gRNA 2a or 2bDepositorInsertSpCas9 gRNA 1b to create OPA1-del_exon5
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-SpCas9_gRNA-OPA1-createR194G-A9-gRNA_(CJT87)
Plasmid#226988PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-R194G cell line via adenine base editing (target base in position A9)DepositorInsertSpCas9 gRNA A9 to create OPA1-R194G
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCSDest2-SpCas9-MT3-NLS-3XHA-NLS-ZFP_TS2
Plasmid#69228PurposeExpresses R1335K mutant SpCas9 fused to ZFP-TS2 in mammalian cellDepositorInsertTS2 ZFP
UseCRISPRTagsNLS-3XHA-NLSExpressionMammalianMutationPromoterAvailable sinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCSDest2-SpCas9-MT3-NLS-3XHA-NLS-ZFP_TS4
Plasmid#69230PurposeExpresses R1335K mutant SpCas9 fused to ZFP-TS4 in mammalian cellDepositorInsertTS4 ZFP
UseCRISPRTagsNLS-3XHA-NLSExpressionMammalianMutationPromoterAvailable sinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pED9x (dCas9-KRAB-mCherry)
Plasmid#163956PurposeLentiviral expression plasmid of sgRNA with mCherryDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6 promoter for crRNA expression and EFS promoter…Available sinceMarch 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
Cas9_YTHDF2_sgRNA
Plasmid#186673PurposeYTHDF2 sgRNA plasmidDepositorInsertYTHDF2 KO sgRNA Plasmid (YTHDF2 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pINDUCER dCas9-TET1CDMut
Plasmid#101920PurposeThe dCas9-TET1CDMut fusion protein is cloned into the pINDUCER lentiviral backbone (Addgene plasmid# 46948). The TET1 catalytic domain is mutated to abolish catalytic function.DepositorInsertdCas9-TET1CD Mut
UseLentiviralTagsExpressionMammalianMutationMutated TET1 catalytic domainPromoterAvailable sinceNov. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pattB-LSL-AAVR-F2A-spCas9
Plasmid#202459PurposeThe plasmid backbone used to generate the recombination template to generate the SELECTIV mice through Integrase Mediated Transgenesis. Allows for Cre-dependent expression of AAVR and Cas9.DepositorInsertAAVR (AU040320 Mouse)
UseCRISPR, Cre/Lox, and Mouse TargetingTagsmCherry fusionExpressionMammalianMutationPromoterCAGAvailable sinceAug. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-mCherry
Plasmid#99154PurposeLentiviral vector encoding sgRNA cloning site + hSpCAS9-P2A-mCherry.DepositorInsertsCas9
mCherry
UseCRISPR and LentiviralTagsFLAGExpressionMammalianMutationPromoterEFS-NSAvailable sinceAug. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-AIO-M11-gRNA-EFS-NMS-SadCas9
Plasmid#210710PurposeThis Plasmid express M11 promoter driven SadCas9 specific gRNA and EFS promoter driven NMS transactivation module fused to SadCas9DepositorInsertSadCas9 specific gRNA and NMS fused to N-terminus of SadCas9
UseAAV and CRISPRTagsFLAGExpressionMammalianMutationD10A/N580APromoterM11Available sinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-pCamKII-Cre-pU6-SpCas9gRNAentry
Plasmid#210391PurposeAAV plasmid encoding the CamKII promoter driving Cre expression, along with SpCas9 gRNA entry cassette (RFP dropout)DepositorInsertAAV-(ITR)-pCamKII-NLS-Cre-WPRE-bGHpA-(rev)-SpCas9_gRNA-BsmBI_RFPcassette-hU6-(ITR) (NJA158)
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterCamKII promoter for Cre, human U6 promoter for Sp…Available sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
evoFERNY-Cas9NG
Plasmid#203329PurposePlasmid for bacterial purification of codon optimized evoFERNY-Cas9NGDepositorInsertevoFERNY-Cas9NG
UseCRISPRTagsHis-tagExpressionBacterialMutationPromoterAvailable sinceJune 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBK2043-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9
Plasmid#223163Purpose2nd gen. AAV backbone for dSaCas9 (endonuclease dead Cas9 from Staphylococcus aureus) and Sa-gRNA ScaffoldDepositorTypeEmpty backboneUseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterAvailable sinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-Hsp1-Hsp2Cas9-KY-P2A-puro
Plasmid#192133PurposeExpresses highly specific Hsp1-Hsp2Cas9, cloning backbone for sgRNA and puromycin resistance geneDepositorInsertHsp1-Hsp2Cas9-KY
UseAAVTagsExpressionMammalianMutationHsp1-Hsp2Cas9 (K390A, Y446A)PromoterAvailable sinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-GfABC1D-SaCas9-WPRE3-pA
Plasmid#203540PurposeSaCas9 expression in astrocytesDepositorInsertSaCas9
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA47_dCas9-GFP_YES_i2
Plasmid#231419PurposeThis YES-gate plasmid expresses dCas9 from a constitutive promoter, GFP from a promoter repressible by sgRNA-Y, and sgRNA-Y repressible by sgRNA-2.DepositorInsertsdCas9
GFP
sgRNA-Y
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCSDest2-2XNLS-SpCas9-WT-NLS-3XHA-NLS-TALentry
Plasmid#69232PurposeWild type SpCas9 expression plasmid to clone TALEs through BbsI site (generates compatible overhangs with Acc65I and BamHI sites)DepositorInsertSpCas9
UseCRISPRTags2X NLS, BbsI TALE entry cassette, and NLS-3XHA-NL…ExpressionMammalianMutationPromoterAvailable sinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
PX458-3xHA-dFnCas9
Plasmid#201954PurposeMammalian expression plasmid of dead FnCas9 with T2A-EGFP and cloning backbone for sgRNADepositorInsert3xHA-NLS-dFnCas9-T2A-EGFP
UseCRISPRTags3xHA, NLS, and T2A-EGFPExpressionMammalianMutationD11A and H969A on FnCas9PromoterCbhAvailable sinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-S12
Plasmid#84031PurposeTo episomally express codon optimized Cas9 and chimeric guide RNADepositorInsertshSpCas9
eGFP
UseTags3x FLAGExpressionMammalianMutationPromoterCMV and CMV (downstream of F2A self-cleaving pept…Available sinceAug. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
LLP774_dCas9-Spy-Snoop-Sunx5-Avi-Tag-BFP (dCas9-SSSavi-BFP)
Plasmid#211767PurposedCas9 docking array with four tag domains (Spy, Snoop, aGCN4, Avi), with BFP selectionDepositorInsertdCas9, Spy, Snoop, aGCN4, AviTags
UseTags3xHAExpressionMammalianMutationdCas9 D10A and H840APromoterpGK and pEF1aAvailable sinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-huTET1CD-T2A-GFP (PX458)
Plasmid#129025Purposetargeted DNA demethylation, expression of dCas9-huTET1CD-T2A-EGFP and cloning backbone for sgRNADepositorInsertdCas9-huTET1CD, SgRNA cloning site
UseTagsHA-Tag, NLS and T2A-EGFPExpressionMammalianMutationdCas9 (D10A;H840A)PromoterCbH (for dCas9-huTET1CD-T2A-EGFP) U6 (for sgRNA)Available sinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-huTET1CD-T2A-mCherry(PX458)
Plasmid#129027Purposetargeted DNA demethylation, expression of dCas9-huTET1CD-T2A-mCherry and cloning backbone for sgRNADepositorInsertdCas9-huTET1CD, SgRNA cloning site
UseTagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A)PromoterCbH (for dCas9-huTET1CD-T2A-EGFP) U6 (for sgRNA)Available sinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
874V=βTub-NLS-hSpCas9-T2A-GFP, Opie2-dsRed-SV40
Plasmid#159672PurposePlasmid supports Cas9 expression only in males, Opie2-dsRed tagged, and can be integrated with pBac or phC31.DepositorInsertβTub-NLS-hSpCas9-T2A-GFP
UseTagsT2A-GFPExpressionInsectMutationPromoterAvailable sinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
874U=ExuL-NLS-hSpCas9-T2A-GFP, Opie2-dsRed-SV40
Plasmid#159671PurposePlasmid supports Cas9 expression only in males, Opie2-dsRed tagged, and can be integrated with pBac or phC31.DepositorInsertExuL-NLS-hSpCas9-T2A-GFP
UseTagsT2A-GFPExpressionInsectMutationPromoterAvailable sinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pACRISPR
Plasmid#113348PurposeA sgRNA expression plasmid for genome editing in Pseudomonas aeruginosaDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceAug. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV2ss-U6-sgHTT1-7sk-sgCas9
Plasmid#190900PurposeAAV-KamiCas9 vector expressing sgGFP and human HTT sgRNAsDepositorInsertsgRNA (HTT spCas9, Human)
UseAAV and CRISPRTagsExpressionMutationPromoterU6 and 7skAvailable sinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAVss-U6-sgHTT51-7sk-Cas9
Plasmid#190901PurposeAAV-KamiCas9 vector expressing sgGFP and mouse HTT sgRNADepositorInsertsgRNA (Htt Mouse)
UseAAV and CRISPRTagsExpressionMutationPromoterU6 and 7skAvailable sinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only