We narrowed to 22,283 results for: fus
-
Plasmid#71393PurposeLentiviral vector of luciferase-eGFP fusion gene driven by FerH promoterDepositorInsertFerH-ffLuc2-eGFP
UseLentiviralTagsExpressionMammalianMutationPromoterFerHAvailable sinceDec. 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-BBS7
Plasmid#218715PurposeExpresses N-terminally EGFP-tagged BBS7 in mammalian cellsDepositorInsertBBS7 (BBS7 Human)
UseTagsEGFPExpressionMammalianMutationPromoterCMVAvailable sinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available sinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMRXIP VPS16-GFP
Plasmid#67023PurposeHuman VPS16 ORF was inserted into pMRXIP GFP-N vectorDepositorInsertHomo sapiens vacuolar protein sorting 16 homolog (S. cerevisiae) (VPS16) (VPS16 Human)
UseRetroviralTagsGFPExpressionMutationPromoterCMVAvailable sinceAug. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
hCD4-mOrange
Plasmid#110192PurposeEncodes for human CD4 coding sequence tagged with the mOrange FPDepositorInserthCD4 (CD4 Human)
UseTagsmOrangeExpressionMammalianMutationPromoterCMVAvailable sinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET24a-VHH-mCherry
Plasmid#109421PurposeBacterial expression of a functionalized anti-GFP (VHH) nanobody fused to mCherry. VHH-mCherry also contains a T7, HA, BAP and His6 epitopeDepositorInsertanti-GFP nanobody fused to a T7, mCherry, HA, BAP and His6 epitope
UseTagsBAP, HA, His6, and T7ExpressionBacterialMutationPromoterT7Available sinceJune 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCD5-D/bovine/Nebraska/9-5/2012-HEFs57aED-GCN4-sfGFP-ST
Plasmid#175020PurposeExpresses influenza D virus trimeric hemagglutinin esterase fusion protein fused to a sfGFPDepositorInsertD/bovine/Nebraska/9-5/2012
UseTagsGCN4-TEV-sfGFP-TwinStrepExpressionMammalianMutations57a esterase knock out mutantPromoterCMVAvailable sinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
EGFP gRNA (BRDN0000562805)
Plasmid#80035Purpose3rd generation lentiviral gRNA plasmid targeting EGFPDepositorInsertEGFP
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR P2R-P3-SV40 polyA signal
Plasmid#48627PurposeContributes a cassette containing an SV40 polyA signal as the 3’-module during MultiSite Gateway cloning of chimeric cDNAs, when a peptide module at the C-terminal end is not required.DepositorInsertSV40 early polyadenylation signal cassette
UseGateway entry vectorTagsExpressionMutationPromoternoneAvailable sinceApril 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV_NOPlight1
Plasmid#195578PurposeExpresses NOPLight1 in mammalian cellsDepositorInsertNOPLight1
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET14b-dabAB2
Plasmid#133013PurposepET14b carrying the dabA2 gene (Uniprot: D0KWS7) with a c-terminal strep tag fusion and the dabB2 gene (Uniprot: D0KWS8) with a c-terminal sfGFP V206K fusion and 6xHis tagDepositorInsertsdabB2
dabA2
UseTags6xHis, StrepII tag, and sfGFPExpressionBacterialMutationPromotert7Available sinceNov. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
mCyRFP1-RhoA
Plasmid#84358Purposefusion protein of RhoA, FRET donorDepositorInsertmCyRFP1-RhoA (RHOA Synthetic, Human)
UseTagsmCyRFP1 N terminal fusion to RhoAExpressionMammalianMutationPromoterCMVAvailable sinceNov. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
B-MFF
Plasmid#141158PurposeDimerization-dependent fluorescent protein binding partner targeted to outer mitochondrial membraneDepositorInsertmitochondrial fission factor (MFF Human)
UseTagsGBExpressionMammalianMutationPromoterCMVAvailable sinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-BBS5
Plasmid#218714PurposeExpresses N-terminally EGFP-tagged BBS5 in mammalian cellsDepositorInsertBBS5 (BBS5 Human)
UseTagsEGFPExpressionMammalianMutationPromoterCMVAvailable sinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTDpelB-NTwinStrep
Plasmid#45940Purposeuse to create N-terminal PelB-Twin-Strep-tag fusion proteins or dual tagged fusion with N-terminal PelB-Twin-Strep-tag and C-terminal 6x His-tag for periplasmic translocation via PelB signal sequenceDepositorTypeEmpty backboneUseTags6xHis, PelB, and Twin-StrepExpressionBacterialMutationPromoterTrc (lactose/IPTG inducible)Available sinceSept. 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
GST-BHMT-I/G
Plasmid#104442PurposeAutophagy cargo assayDepositorInsertBHMT (BHMT Human)
UseTagsGFP-myc GFP is from Aequorea victoria and GSTExpressionMammalianMutationN43A in GST (in a potential KFERQ-like sequence).…PromoterCMVAvailable sinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTet-On-TAP
Plasmid#59017PurposeConstruct allows tetracycline inducible expression of a protein of interest fused to a tandem affinity purification tag (TAP) in toxoplasma gondii.DepositorTypeEmpty backboneUseToxoplasma expressionTagsCalmodulin Binding Peptide fused with a TEV Cleav…ExpressionMutationPromoterRPS13 with Tet Operators InsertedAvailable sinceSept. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
Affibody HER2:243.BirA*-pET301/NT-DEST
Plasmid#174692PurposePlasmid encoding for the bacterial expression of a bispecific coding for the anti-HER2 affibody ZHER2:342 fused to the mutated form of BirA enzyme, BirA*DepositorInsertAnti-HER2 affibody ZHER2:342 fused to mutated form of BirA, BirA*
UseTagsHIS tagExpressionBacterialMutationR118G mutation in BirAPromoterT7 promoterAvailable sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-ADARcd-YTHD422N
Plasmid#194402PurposeADAR1 catalytic domain E488Q fused to YTHD422NDepositorInsertADARcd fused to YTHD422N (ADAR Human)
UseTagsADARcd-YTHD422N-HAExpressionMammalianMutationD422N mutation in the YTH domain to enhance m6A b…PromoterAvailable sinceJan. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDT386
Plasmid#174733PurposeExpresses His-tagged DT386, a truncated diphtheria toxin without a receptor-binding domain.DepositorInsertDT386
UseTagsHistagExpressionBacterialMutationDeleted amino acids 412-560 (the receptor binding…PromoterT5Available sinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
GA-MFF
Plasmid#141160PurposeDimerization-dependent green fluorescent protein targeted to mitochondrial outer membraneDepositorInsertmitochondrial fission factor (MFF Human)
UseTagsGAExpressionMammalianMutationPromoterAvailable sinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSC-PreE2
Plasmid#52264PurposeBacterial expression of GST-tagged TARGET proteins fused to SUMO-E2 with PreScission protease cleavage site linkerDepositorInsertUbc9 GST fusion (UBE2I Human)
UseTagsGSTExpressionBacterialMutationPromoterAvailable sinceJuly 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
pET24a-VHH-tev-mCherry
Plasmid#117752PurposeBacterial expression of a functionalized anti-GFP (VHH) nanobody fused to mCherry. VHH-mCherry also contains a T7, HA, BAP, tev cleavage site and His6 epitopeDepositorInsertanti-GFP nanobody fused to a T7, tev site, mCherry, HA, BAP and His6 epitope
UseTagsBAP, HA, His6, and T7ExpressionBacterialMutationPromoterT7Available sinceFeb. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
TetO-FUW-VdC9BV
Plasmid#62195PurposeExpresses RNA-Guided, Nuclease-Inactive VP64:dCas9-BFP:VP64—VdC9BV—Fusion Protein to Enable Transactivation of Endogenous GenesDepositorInsertVP64dCas9BFPVP64
UseLentiviralTagsTwo VP64s tagged to dCas9 fused to BFPExpressionMammalianMutationD10A H840A (catalytically inactive) Cas9 (dCas9)PromoterAvailable sinceJune 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
gWiz_BM40-vGAT-VH-hIgG1-CH1-TS-HIS
Plasmid#218436Purposemammalian expression plasmid for the heavy chain fragment of an anti-vGAT Fab domainDepositorInsertvGAT-Vh-hIgG1-CH1
UseAffinity Reagent/ AntibodyTagsBM40 and TwinStrep-6xHisExpressionMammalianMutationPromoterCMVAvailable sinceApril 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSC-IntE2
Plasmid#52265PurposeBacterial expression of GST-tagged TARGET proteins fused to SUMO-E2 with GyrA intein linkerDepositorInsertUbc9 GST fusion (UBE2I Synthetic, Human)
UseTagsGST and GyrA-inteinExpressionBacterialMutationPromoterAvailable sinceJuly 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
mMaple-OMP25
Plasmid#141151PurposePhotoconvertible fluorescent protein targeted to the outer mitochondrial membrane (OMM) in mammalian cells.DepositorInsertOMP25 (Synj2bp Rat)
UseTagsmMapleExpressionMammalianMutationOMP25 c terminus from addgene plasmid #69598PromoterCMVAvailable sinceAug. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYPQ-dpcoCas9-Act3.0
Plasmid#158408PurposeCRISPR-Act3.0 system containing dpcoCas9-VP64 fusion protein, T2A linked MS2-SunTag fusion protein, and ScFv-sfGFP-2xTAD activator.DepositorInsertdpcoCas9-VP64-T2A-MS2-SunTag-rbcS-E9t-ter-ZmUbi-scFv-sfGFP-2xTAD-GB1-NOS-ter
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
SnFR-gamma2
Plasmid#165495PurposeGreen fluorescent glutamate reporter fused to TARP gamma-2 for mammalian expression.DepositorInsertiGluSnFR extracellular domain fused to Stargazin (gamma-2) via NETO2 TM domain (Cacng2 Rat, Synthetic)
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceMarch 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLGCV
Plasmid#49862PurposeExpression in Caenorhabditis elegans of the luc+ gene (Promega), fused in frame to GFP (S65C), under the sur-5 promoter (from plasmid pTG96, John Yochem and Min Han). Backbone pPD95.79 (Firelab).DepositorInsertfirefly luciferase luc+ fused to GFP (S65C)
UseTagsGFP (S65C)ExpressionWormMutationPromotersur-5Available sinceApril 17, 2014AvailabilityAcademic Institutions and Nonprofits only