We narrowed to 1,564 results for: CAG promoter
-
Plasmid#174383PurposeThe plasmids carrying a mini-CRISPR array were used to express crRNAs; article demonstrates use in Haloferax mediterraneiDepositorInserta crRNA targeting the template strand
UseCRISPR; Archaeal expressionExpressionBacterialPromoterPhaR promoterAvailable SinceNov. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPN217
Plasmid#91676PurposeExpress sgRNA targeting human TLE1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTC365
Plasmid#91214Purposeprotoplast vector expressing 2 gRNAs targeting tomato ARF8A (CmYLCV promoter, tRNA processing)DepositorInsert2 gRNAs targeting tomato ARF8A
UseCRISPRExpressionPlantAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN022
Plasmid#91668PurposeExpress sgRNA targeting human SHANK3DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTC363
Plasmid#91211Purposeprotoplast vector expressing 2 gRNAs targeting tomato ARF8A (AtU6 and AtU6 promoters)DepositorInsert2 gRNAs targeting tomato ARF8A
UseCRISPRExpressionPlantAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN216
Plasmid#91675PurposeExpress sgRNA targeting human TLE1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTC303
Plasmid#91210Purposeprotoplast vector expressing 2 gRNAs targeting tomato ARF8A (AtU6 and AtSL7 promoters)DepositorInsert2 gRNAs targeting tomato ARF8A
UseCRISPRExpressionPlantAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN219
Plasmid#91678PurposeExpress sgRNA targeting human TLE3DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTC441
Plasmid#91218Purposeprotoplast vector for targeted deletion of MLO gene in barley (PvUbi1 promoter driving the gRNA array)DepositorInsertgRNAs targeting MLO gene in barley
UseCRISPRExpressionPlantAvailable SinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTC437
Plasmid#91219Purposeprotoplast vector for targeted deletion of MLO gene in barley (CmYLCV promoter driving the gRNA array)DepositorInsertgRNAs targeting MLO gene in barley
UseCRISPRExpressionPlantAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSC32
Plasmid#104806PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr2g101090 (Pen3). Also expresses Cas9 from AtUBQ10 promoter.DepositorInsertMedtr2g101090
UseCRISPRExpressionPlantAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC31
Plasmid#104805PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr2g101090 (Pen3). Also expresses Cas9 from Gmubi promoter.DepositorInsertMedtr2g101090
UseCRISPRExpressionPlantAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC27
Plasmid#104801PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr4g020620 (Pho2ab). Also expresses Cas9 from Gmubi promoter.DepositorInsertMedtr4g020620
UseCRISPRExpressionPlantAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPN159
Plasmid#91688PurposeExpress sgRNA targeting human ZSWIM6DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN156
Plasmid#91685PurposeExpress sgRNA targeting human ZNF804ADepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN118
Plasmid#91645PurposeExpress sgRNA targeting human MPP6DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN276
Plasmid#91647PurposeExpress sgRNA targeting human PLCH2DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN135
Plasmid#91649PurposeExpress sgRNA targeting human SATB2DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN129
Plasmid#91652PurposeExpress sgRNA targeting human PTGISDepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN134
Plasmid#91661PurposeExpress sgRNA targeting human SATB2DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTC366
Plasmid#91215Purposeprotoplast vector expressing 2 gRNAs targeting tomato ARF8A (CmYLCV promoter, ribozyme processing)DepositorInsert2 gRNAs targeting tomato ARF8A
UseCRISPRExpressionPlantAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_TFRC_C (with mCherry)
Plasmid#72627PurposeExpresses two gRNAs targeting the TFRC promoterDepositorInsertgRNAs toward TFRC
ExpressionMammalianPromoterU6 (gRNA1) and H1 (gRNA2)Available SinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pR008_APAD
Plasmid#204818PurposeExpression Apobec1-ADAR2dd fusion protein as PIE-RBP controlDepositorInsertrat Apobec1 and human ADAR2 deaminase domain with engineered sites (Apobec1 Rat)
TagsHA and Flag and huADAR2ddExpressionMammalianPromoterchicken β-actin promoterAvailable SinceNov. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPN447
Plasmid#137871PurposeExpression of gRNA targeting POGZ for CRISPRi; U6 promoterDepositorAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-mNeurog2 gRNA_1-MS2-Puro
Plasmid#192680PurposeLentiviral expression of sgRNA targeting mIL1RN promoter to activate mouse Neurog2 transcriptionDepositorInsertMouse Neurog2 activating gRNA #1 (Neurog2 Mouse)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6_rd6_nsgRNA(PP7)
Plasmid#232434PurposensgRNA for PE3b correction of the rd6 mutation, contains a PP7 in the scaffold tetraloopDepositorInsertPP7-tagged nicking gRNA (PE3b) for rd6 correction driven by human U6 promoter
UseCRISPRPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACEMam2-TRPML1
Plasmid#238303PurposeExpression of human TRPML1 in mammalian cellsDepositorArticleInsertTRPML1 (MCOLN1 Human)
Tags8xHis-3xFLAG-TEVExpressionMammalianPromoterhybrid CAG promoterAvailable SinceJune 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-ChrimsonR-tdTomato
Plasmid#99231PurposeAAV-mediated expression of ChrimsonR-tdTomato under the CaMKII promoter. tdTomato has codons varied between the first and second tandem repeats to reduce recombination. Using SV40 signal.DepositorInsertChrimsonR-tdTomato
UseAAVTagstdTomatoExpressionMammalianMutationChrimson K176R mutantPromoterCaMKIIAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-Syn-FLPX-rc [ChrimsonR-tdTomato]
Plasmid#128589PurposeAAV-mediated expression of ChrimsonR-tdTomato under the Syn promoter in frt/reversed (Flp-dependent) manner. tdTomato has codons varied to reduce recombination.DepositorHas ServiceAAV8InsertChrimsonR-tdTomato
UseAAVTagstdTomato (codon diversified version)ExpressionMammalianMutationChrimson K176R mutantPromoterSynAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgBrip1#2/Cre
Plasmid#193204PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Brip1 geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgFlt4#1/Cre
Plasmid#193215PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Flt4 geneDepositorAvailable SinceDec. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
JPF0512
Plasmid#124003PurposeEncodes promoter-less expression of mAzamiGreen with an mScarlet normalization in a PiggyBac destination vectorDepositorInsertPB_spacer-NLS-mAzamiGreen-bghpA_pCAG-H2B::mScarlet-rglpA
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
L4440_BioBrick-hsf-1-sgRNA-A
Plasmid#177786PurposeOverexpression of sgRNAs in E. coli HT115 (targeting C. elegans hsf-1 promoter)DepositorInserthsf-1 (hsf-1 Nematode)
ExpressionBacterialAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAH750
Plasmid#91212Purposeprotoplast vector expressing 2 gRNAs targeting tomato ARF8A (AtU6 and AtSL7 promoters, structurally optimized gRNA scaffolds)DepositorInsert2 gRNAs targeting tomato ARF8A
UseCRISPRExpressionPlantAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSLQ9834_sgTet: pHR-hU6-CasMINI sgRNA_#2 (sgTet); EF1a-Puro-T2A-BFP- WPRE
Plasmid#176273PurposeExpression of CasMINI sgRNA targeting TRE3G promoter in dCasMINI-mediated GFP activation assays.DepositorInsertCasMINI sgRNA (sgTet) and BFP
UseLentiviralExpressionMammalianPromoterU6Available SinceOct. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti X2 Neo/pTER shEGFP#2 (w22-2)
Plasmid#17480Purpose3rd gen lentiviral eGFP shRNA #2 (H1/TO promoter), 3’LTR insertion, NeoDepositorInsertEnhanced green fluorescent protein shRNA #2
UseLentiviral and RNAiAvailable SinceAug. 12, 2009AvailabilityAcademic Institutions and Nonprofits only -
p3E-U6a-U6c-mfn2 guide
Plasmid#121993PurposeAn entry vector with U6a and U6c promoter driving mfn2 guide RNAs expressionDepositorInsertmfn2 gRNA
UseCRISPRAvailable SinceSept. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSC39
Plasmid#104813PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr2g101180 (Cop-like). Also expresses Cas9 from Gmubi promoter.DepositorInsertMedtr2g101180
UseCRISPRExpressionPlantAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
LT3GEPIR-WT1shRNA
Plasmid#220560PurposeTo inducibly knockdown WT1 or EWSR1::WT1 expressionDepositorAvailable SinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJY-RpABE-PDS3_IMS
Plasmid#112875Purposebinary vector for IMS (Induced Mis-Splicing) of PDS3 in ArabidopsisDepositorInsertsRPS5A promoter
ABE7.10
U6-sgRNA targeting PDS3
UseCRISPRExpressionPlantAvailable SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1-G7
Plasmid#173203PurposeExpresses the ATP1A1 G7 sgRNA in combination with FLAGless eSpCas9(1.1) to target ATP1A1 intron 17. pX330-like plasmid.DepositorInsertATP1A1 G7 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti.hUbC.H2B-CeruleanFP-2A-Dendra2FP.W
Plasmid#126522PurposeLentivector that expresses H2B-Cerulean and Dendra2 fluorescent proteins from an internal hUbC promoter.DepositorInsertH2B-CeruleanFP-2A-Dendra2FP
UseLentiviralPromoterhUbCAvailable SinceMay 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
gRNAs[bTub+Tra].1046D
Plasmid#112693Purposeexpress two gRNA targeting bTub & Tra under dU6-3 promoterDepositorInsertU6.3-gRNA[bTub] & U6.3-gRNA[Tra] (tra Fly)
UseCRISPRAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPN018
Plasmid#91664PurposeExpress sgRNA targeting human SCN2ADepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN272
Plasmid#91643PurposeExpress sgRNA targeting human MMP16DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN017
Plasmid#91663PurposeExpress sgRNA targeting human SCN2ADepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
B270 + SPRTN sgSTOP
Plasmid#100718PurposeB270 plasmid expressing SPRTN sgSTOP (cloned in BbsI site) in combination with ATP1A1 sgSTOPDepositorInsertsgSTOP targeting SPRTN (cloned using BbsI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLG1-puro-sgULK1-1
Plasmid#109004PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLG1-puro-sgATL2-2
Plasmid#109009PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only