177,604 results
-
Plasmid#155297PurposeExpression of spike with C-term deletion of 19 aa, used to generate high efficiency SARS-CoV-2-pseudotyped lentiviral particlesDepositorInsertSARS-Cov2 spike_deleted (S SARS-Cov2)
UseGeneration of sars-cov-2-pseudotyped lentiviral p…MutationDeletion in C-term 19 aa of spikePromoterCMVAvailable sinceAug. 5, 2020AvailabilityIndustry, Academic Institutions, and NonprofitsCited by -
RRL.sin.cPPT.SFFV/Ace2.IRES-puro.WPRE (MT126)
Plasmid#145839PurposeLentiviral vector genome to ectopically express human Ace2DepositorAvailable sinceMay 13, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLenti6.2_mNeonGreen2
Plasmid#113727PurposeExpresses the fluorescent protein mNeonGreen2 in a lentiviral backboneDepositorInsertmNeonGreen2
UseLentiviralExpressionMammalianPromoterCMVAvailable sinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pET29b-IPP1-His
Plasmid#124137PurposeBacterial expression plasmid for PURE system componentsDepositorAvailable sinceApril 19, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAJ075_hsCRBN
Plasmid#124214PurposeInsect cell expression vector for His6 tagged hsCRBNDepositorAvailable sinceApril 16, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PCV-Cas9
Plasmid#123643PurposeExpresses Cas9 with an N-terminal HUH-tag called PCV2DepositorAvailable sinceMarch 27, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
psPAX2-D64V-NC-MS2
Plasmid#122944PurposeMS2 coat protein-modified lentiviral packaging plasmid for packaging mRNA with an MS2 aptamer into lentivirus-like particlesDepositorInsertNC-MCP (MS2 coat protein) fusion protein in Gag
UseLentiviralExpressionMammalianMutationD64VAvailable sinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX459V2.0-HypaCas9
Plasmid#108294PurposepX459 V2.0 (Plasmid #62988) with the N692A, M694A, Q695A, and H698A mutationsDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable sinceJuly 20, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pB-CAGGS-dCas9-KRAB
Plasmid#110822PurposePiggyBac compatible plasmid expressing dCas9-KRABDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertdCas9-KRAB
ExpressionMammalianMutationCas9 mutations to make dCas9=D10A+D839A+H840A+N86…PromoterCAGGSAvailable sinceJuly 17, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA3.1 Dendra2
Plasmid#103967PurposeMammalian expression of fluorescent protein Dendra2 used for transfection efficiency controlDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertDendra2
ExpressionMammalianAvailable sinceJuly 16, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pACYC-Taq
Plasmid#102793PurposeExpresses Taq DNA polymerase under WT T7 promoterDepositorInsertTaq DNA polymerase
ExpressionBacterialAvailable sinceJuly 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable sinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAW63.YY1.FKBP.knock-in.BFP
Plasmid#104371PurposeFor knocking in FKBP F36V P2A BFPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertFKBP12(F36V) -P2A-BFP
Available sinceDec. 21, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
DNA-PKcs T3950D
Plasmid#83320PurposeDNA-PKcs T3950ADepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthuman DNA-PKcs (PRKDC Human)
ExpressionMammalianMutationActivation loop phosphorylation site 3950 substit…Available sinceAug. 8, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSFV-Helper1
Plasmid#92073PurposeThis is a plasmid for transcription of defective helper RNA, providing structural Semliki forest virus (SFV) proteins to package recombinant SFV genomes into virus like particles.DepositorInsertcDNA of SFV genome with deletion removing the nonstructural SFV proteins and also the viral RNA packaging signal.
UseHelper plasmid, for run-off transcription and rna…Available sinceJuly 26, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pET-CjCas9
Plasmid#89754PurposeExpression of CjCas9 with His tag in E.coliDepositorInsertCjCas9
UseCRISPRTags6XHis, HA, and SV40 NLSExpressionBacterialPromoterT7Available sinceMay 25, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA3.1-3xFLAG-V5-ccdB
Plasmid#87064PurposeMammalian Gateway-compatible expression vector backbone with an N-terminal 3xFLAG-V5 tagDepositorTypeEmpty backboneTags3xFLAG-V5ExpressionMammalianAvailable sinceMarch 7, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSLQ2817 pPB: CAG-PYL1-VPR-IRES-Puro-WPRE-SV40PA PGK-ABI-tagBFP-SpdCas9
Plasmid#84239PurposeExpresses ABA-inducible VPR-Sp dCas9DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsABI-tagBFP-Sp dCas9
PYL1-VPR
UseCRISPR and Synthetic Biology; PiggybacTags2xNLS (SV40), ABI, HA tag, IRES-Puro, PYL1, and t…ExpressionMammalianPromoterCAG and PGKAvailable sinceNov. 9, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLV_Zika_NS5_Flag
Plasmid#79639PurposeThird generation Self-inactivating lentivector expressing NS5 from Zika virusDepositorInsertNS5
UseLentiviralTagsFlagExpressionMammalianPromoterEF1Available sinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA3-ALK5 wt
Plasmid#80876Purposemammalian expression of ALK5 WTDepositorAvailable sinceAug. 25, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by