We narrowed to 19,041 results for: Cre
-
Plasmid#128327PurposeReporter to evaluate YAP1/TEAD-mediated gene transcriptionDepositorInsertsUseLentiviralTagsFLAGExpressionMammalianMutationPromoterAvailable sinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pcDNA3-Flag::UbvG08 I44A, deltaGG
Plasmid#74939PurposeUbiquitin variant that binds to and occludes the ligand binding site of the 53BP1 Tudor domain (i53). Blocks 53BP1 from accumulating at sites of DNA damage. Potent selective inhibitor of 53BP1DepositorInsertUbiquitin
UseTagsFlagExpressionMammalianMutationUbvG08 with I44A mutation and no terminal GlycinesPromoterCMVAvailable sinceJune 30, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
AKAP1-hLOV-TEVcs-GAL4bd-VP64-V5
Plasmid#170995PurposeHiLITR transcription factor with AKAP1 N-terminal tmd targeting sequence (mitochondria)DepositorInsertAKAP1(tmd)-NNES-hLOV-TEVcs(ENLYFQ/M)-GAL4bd-VP64-V5 (AKAP1 Synthetic)
UseLentiviral and Synthetic BiologyTagsV5ExpressionMammalianMutationPromoterEf1-alphaAvailable sinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pML333_LAMP1-C-term_XTEN80-mEGFP-3xHA_pTMPLT
Plasmid#227898PurposeHomology repair template for genome engineering. Organelle endogenous marker expressing GFP and epitope tags for mass spectrometry.DepositorInsertLAMP1 homology arms with mEGFP-3xHA for insertion at C terminus
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML334_RAB7A-N-term_XTEN80-mEGFP-3xHA_pTMPLT
Plasmid#227899PurposeHomology repair template for genome engineering. Organelle endogenous marker expressing GFP and epitope tags for mass spectrometry.DepositorInsertRAB7A homology arms with XTEN80-mEGFP-3xHA for insertion at N terminus
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB-AMBRA1-3xFLAG
Plasmid#174159PurposePiggyBac vector to stably express 3xFLAG-tagged AMBRA1DepositorInsertAMBRA1 (AMBRA1 Human)
UseTags3xFLAGExpressionMammalianMutationPromoterEF1AAvailable sinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pML531_TOMM20-C-term_XTEN80-mEGFP-3xHA_pTMPLT
Plasmid#227890PurposeHomology repair template for genome engineering. Organelle endogenous marker expressing GFP and epitope tags for mass spectrometry.DepositorInsertTOMM20 homology arms with mEGFP-3xHA for insertion at C terminus
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Empty)-PGKmCherry2ABFP-W
Plasmid#67985PurposeCas9 activity reporter (control) with mCherry and BFPDepositorInsertU6gRNA cassette, PGKmCherryABFP cassette, WPRE
UseCRISPR and LentiviralTagsExpressionMutationDeleted BbsI site within WPRE, modified BFPPromoterAvailable sinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCAG-enAsCas12a(E174R/S542R/K548R)-NLS(nuc)-3xHA (AAS848)
Plasmid#107941PurposeMammalian expression plasmid for human codon optimized enAsCas12a (enhanced AsCas12a) encoding E174R/S542R/K548R substitutionsDepositorInserthuman codon optimized enAsCas12a (E174R/S542R/K548R)
UseTags3x HA and NLS (nucleoplasmin)ExpressionMammalianMutationE174R, S542R and K548RPromoterCAGAvailable sinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_RB1#2
Plasmid#174151PurposeLentiviral vector expressing Cas9 and a sgRNA against the human RB1 geneDepositorInsertRB1 (RB1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EF-FH-TAZ S89A-ires-blast
Plasmid#52084PurposeLentiviral expression vector for TAZ S89A mutant with N-terminal FLAG and His tagsDepositorInsertTAZ S89A (WWTR1 Human)
UseLentiviralTagsFLAG and HisExpressionMammalianMutationS89APromoterEF1aAvailable sinceApril 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-mU6gRNA5(SapI)-hU6gRNA5(BbsI)-PGKpuroBFP-W
Plasmid#72667PurposeLentiviral dual CRISPR gRNA expression vector (mouse U6 and human U6 promoters)DepositorInsertmU6gRNA cassette, hU6gRNA cassette, PGKpuroBFP cassette, WPRE
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceOct. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TDP-REGv2(mScarlet-FLAG)#11 in pTwist-CMV backbone
Plasmid#216155PurposeExpresses mScarlet in cells with TDP-43 loss-of-function. Very bright and decent dynamic range (>10-fold), slightly leaky. It uses a single intron. [Code 'B12']. Note: It is not recommended to produce lentiviruses containing TDP-REG sequences – see Depositor CommentsDepositorInsertmScarlet with cryptic splice site and C-terminal FLAG tag
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(BbsI)-PGKpuro2AZsG-W
Plasmid#67975PurposeCRISPR gRNA expression vector with an improved scaffold and puro/ZsG markersDepositorInsertU6gRNA cassette, PGKpuro2AZsG cassette, WPRE
UseLentiviralTagsExpressionMutationDeleted BbsI site within WPREPromoterhuman U6 promoter, mouse PGK promoterAvailable sinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLX304-ARNT-d414
Plasmid#203579PurposeExpresses a functionally inactive version of ARNT with 5’ 414 bp deletion [Δ414] in mammalian cells.DepositorInsertARNT (ARNT Human)
UseLentiviralTagsV5ExpressionMammalianMutation5' 414 basepair deletion [Δ414]PromoterCMVAvailable sinceFeb. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-EF1a-BsdCas9-W
Plasmid#67978PurposeLentiviral vector expressing Cas9 fused with the Blasticidin resistant gene at the N-terminusDepositorInsertEF1a-Cas9 cassette, WPRE
UseCRISPR and LentiviralTagsCas9 fused with Flag-tag and a NLS at the N termi…ExpressionMutationPromoterEF1aAvailable sinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2 TDP-43 NLS1, 5F-L YFP
Plasmid#84913PurposeMammalian expresion of TDP-43 NLS1, 5F-L YFPDepositorInsertTDP-43 (TARDBP Human)
UseTagsYFPExpressionMammalianMutationK82A, R83A, K84A, F147L, F149L, F194L, F229L, F23…PromoterCMVAvailable sinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pK27Sumo_His-SUMO-PLpro (nsp3) (SARS-CoV-2)
Plasmid#169193PurposeTo express SARS-CoV-2 Papain-like protease in E. coliDepositorInsert14His-SUMO-nsp3_E746-K1060 (pp1ab_E1564-K1878) (ORF1ab Synthetic, SARS-CoV-2)
UseTags14His-SUMOExpressionBacterialMutationCodon optimised for E. coliPromoterT5Available sinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-iGluSnFR4s-PDGFR-WPRE
Plasmid#234435PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and slow deactivation kinetics (4s = slow); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4s-PDGFR
UseAAVTagsIgK chain and Myc epi tag-PDGFR TM DomainExpressionMammalianMutationPromoterSynapsinAvailable sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28b-SpRY-His
Plasmid#179320PurposePlasmid for bacterial expression and purification of SpRY-Cas9DepositorInsertHuman codon-optimized Cas9 variant SpRY
UseCRISPRTags6xHis and SV40-NLSExpressionBacterialMutationSpRY=A61R/L1111R/D1135L/S1136W/G1218K/E1219Q/ N13…PromoterAvailable sinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-nSpCas9-APOBEC3A
Plasmid#209040PurposeLentiviral vector expressing doxycycline-inducible human codon-optimized cytosine base editor where APOBEC3A is fused to the N-terminus of SpCas9(D10A)-sDNA Rad51-2xUGI-6xNLSDepositorInsertAPOBEC3A-nSpCas9
UseCRISPR and LentiviralTagsFLAG-HAExpressionMammalianMutationD10APromoterTight TRE promoterAvailable sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS416-dCas9-Mxi1 + TetR + pRPR1(TetO)-NotI-gRNA
Plasmid#73796PurposepRS416 Ura marked Cen/Ars plasmid with dCas9-Mxi1 under Tef1 promoter, and tet-incucibile RPR1 promoter with NotI cloning site adjacent to gRNADepositorInsertsdCas9-Mxi1
Tet Repressor
Structural gRNA for S pyogenes
UseCRISPRTagsMxi1 and NLSExpressionYeastMutationD10A, H840APromoterpGPM1, pRPR1(TetO), and pTef1Available sinceMarch 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3ExpressionMutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…PromoterAvailable sinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(BbsI)-PGKpuro2AmAG-W
Plasmid#67976PurposeCRISPR gRNA expression vector with an improved scaffold and puro/mAG markersDepositorInsertU6gRNA cassette, PGKpuro2AmAG cassette, WPRE
UseLentiviralTagsExpressionMutationDeleted BbsI site within WPREPromoterhuman U6 promoter, mouse PGK promoterAvailable sinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV TRE3G Neo GFP-Lamin A wildtype
Plasmid#118709PurposeLentiviral TET-ON inducible GFP-Lamin A wildtypeDepositorInsertGFP-Lamin A human wildtype (LMNA Human)
UseLentiviral; Tet-on inducibleTagsGFPExpressionMammalianMutationPromoterCMV TRE3G (TET-ON)Available sinceNov. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-iGluSnFR4s-PDGFR-WPRE
Plasmid#234445PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and slow deactivation kinetics (4s = slow); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4s-PDGFR
UseAAVTagsIgK chain and Myc epi tag-PDGFR TM DomainExpressionMammalianMutationPromoterGFAPAvailable sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
hSyn Marina-T2A-nls-mCherry
Plasmid#85843Purposegenetically-encoded fluorescent voltage indicatorDepositorInsertGEVI Marina
UseTagsmCherryExpressionMammalianMutationCi-VSP contains R217Q mutation; super ecliptic pH…PromoterhSyn1Available sinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-iGluSnFR4f-PDGFR-WPRE
Plasmid#234446PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and fast deactivation kinetics (4f = fast); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4f-PDGFR
UseAAVTagsIgK chain and Myc epi tag-PDGFR TM DomainExpressionMammalianMutationPromoterGFAPAvailable sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-MYO5C
Plasmid#135404PurposeExpresses GFP-tagged human MYO5C in mammalian cells.DepositorInsertMYO5C (MYO5C Human)
UseTagsEGFPExpressionMammalianMutationRelative to the GenBank MYO5C cDNA sequence repor…PromoterCMVAvailable sinceDec. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EF-FH-TAZ-ires-blast
Plasmid#52083PurposeLentiviral expression vector for TAZ with N-terminal FLAG and His tagsDepositorInsertTAZ (WWTR1 Human)
UseLentiviralTagsFLAG and HisExpressionMammalianMutationPromoterEF1aAvailable sinceApril 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-i53
Plasmid#92170Purposerecombinant adeno-associated viral plasmid for delivery and expression of ubiquitin variant (i53) that is a selective inhibitor of 53BP1DepositorInserti53
UseAAVTagsFLAGExpressionMammalianMutationUbvG08 with I44A mutation and no terminal GlycinesPromoterCMVAvailable sinceJuly 13, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
pINDUCER20_mStrawberry_Atg4BC74A
Plasmid#161735PurposeDoxycycline-inducible expression of Atg4B(C74A) fused with mStrawberry to inhibit autophagyDepositorInsertAtg4B(C74A) (Atg4b Mouse) (Atg4b Mouse)
UseLentiviral; Destinatioin vector for gateway cloni…TagsmStrawberryExpressionMammalianMutation220-222 TGC (Cys) is changed to GCA (Ala)PromoterAvailable sinceDec. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Empty)-PGKmCherry2AGFP-W
Plasmid#67981PurposeCas9 activity reporter (control) with mCherry and GFPDepositorInsertU6gRNA cassette, PGKmCherry2AGFP cassette, WPRE
UseCRISPR and LentiviralTagsExpressionMutationDeleted BbsI site within WPREPromoterAvailable sinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLPC-dnMAML1-mVenus
Plasmid#171023PurposeRetroviral vector for CMV promoter driven expression of dominant negative (DN) MAML1 (Notch pathway) fused to mVenus fluorescent protein (to be used in conjunction with Phoenix packaging cells).DepositorInsertMAML1 Dominant Negative (MAML1 Human)
UseRetroviralTagsmVenusExpressionMammalianMutationamino acids 12-74 only, hence conferring dominant…PromoterCMVAvailable sinceApril 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDL52 (clone45)
Plasmid#188578PurposeHigh-yield production of coenzyme F420 in E. coliDepositorInsertsribA
ribD
yigB
fbiC
cofC
cofD
cofI
cofE
UseTagsExpressionBacterialMutationCodon optimization, synthetic ribosome binding si…PromoterT7 variantsAvailable sinceSept. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBFC0996
Plasmid#186695PurposeVcDART under control of Lac promoter, Vc_2xBsaI_NT gRNA, 2xLguI cargo stuffer, with ET-Seq (AsiSI+SbfI) restriction sites flanking Tn7 Right EndDepositorInsertstnsA
tnsB
tnsC
tnsD
tniQ
cas8-cas5 fusion
cas7
cas6
crRNA
Tn7 transposon
2xLguI Cargo Stuffer
SbfI+AsiSI dual restriction site for donor plasmid removal during ET-Seq
UseTagsExpressionBacterialMutationPromoterPLacAvailable sinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOT_6 - lenti-EFS-FMC6.3-BBz-2A-puro-2A-tNGFR
Plasmid#181975PurposeExpresses anti-CD19 CAR (with 4-1BB signaling domain) linked to puromycin resistance via P2A and to human truncated NGFR via T2A for lentiviral delivery.DepositorInsertFMC6.3-BBz CAR; tNGFR (NGFR Synthetic, Human)
UseLentiviralTagsExpressionMutationNGFR truncation: aa 11-276PromoterAvailable sinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pK27Sumo_His-SUMO-nsp10-nsp14 fusion (SARS-CoV-2)
Plasmid#169161PurposeTo express nsp10-nsp14 fusion protein in E. coliDepositorInsert14His-SUMO-nsp10-GGSGGS-nsp14 (ORF1ab Synthetic, SARS-CoV-2)
UseTags14His-SUMO and Fusion protein of SARS-CoV-2 nsp10…ExpressionBacterialMutationCodon optimised for E. coliPromoterT5Available sinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-iGluSnFR4f-PDGFR-WPRE
Plasmid#234450PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and fast deactivation kinetics (4f = fast); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4f-PDGFR
UseAAVTagsIgK chain and Myc epi tag-PDGFR TM DomainExpressionMammalianMutationPromoterCAGAvailable sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA3(BbsI)-PGKpuro2ABFP
Plasmid#67990PurposeCRISPR gRNA expression vector with the conventional scaffold and puro/BFP markers without WPREDepositorInsertU6gRNA cassette with the conventional scaffold, PGKpuro2ABFP cassette
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only