We narrowed to 13,614 results for: sequence
-
Plasmid#50852PurposeExpresses one ddFP in mammalian cells, the second plasmid for a red to green colour switch-based fluorescent caspase-3 biosensor, used together with plasmid NESRA-DEVD-BNLS.DepositorInsertddGFP A
Tagstriplicated NLS sequence DPKKKRKVExpressionMammalianPromoterCMVAvailable SinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAG26
Plasmid#226743PurposeExpresses a reporter for a mitochondrial intermembrane space proteinDepositorAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTP434
Plasmid#104167PurposeBacterial expression plasmid of anti-GFP nanobody with 3x Cysteines for maleimide labelingDepositorInsertAnti-GFP nanobody Enhancer PDB 3K1K (3x Cysteine)
Tags14x Histidine tag and NEDD8 from Brachypodium dis…ExpressionBacterialMutation3x Cysteines located at bps 493-495, 520-522, and…Available SinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
VE-cad KI gRNA1
Plasmid#92310PurposeCRISPR-GFP-gRNA for cutting VEcadDepositorAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.TRC1.shmNsd1.1, puro
Plasmid#114446PurposeLentiviral vector for expression of shRNA sequence targeting mouse Nsd1DepositorInsertshNsd1.1 (Nsd1 Mouse)
UseLentiviral and RNAiAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
RANLS
Plasmid#50843PurposeExpresses one ddFP in mammalian cells, the second plasmid for a green to red colour switch-based fluorescent caspase-3 biosensor, used together with plasmid GANES-DEVD-BNLS.DepositorInsertddRFP A
Tagstriplicated NLS sequence DPKKKRKVExpressionMammalianPromoterCMVAvailable SinceJan. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBUN6A11
Plasmid#50579PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-VP64, gRNA scaffold for insertion of target sequence (OsU3 promoter), Bar resistanceDepositorInsertsdCas9-VP64
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG, HA, and NLSMutationdCas9 = defective in DNA cleavage; 4×minimal VP16…PromoterOsU3p and Ubi1pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 (NT17)
Plasmid#49085PurposeExpresses human NKCC1 with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites. Native hNKCC1 amino acid sequenceDepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and mVenusExpressionMammalianMutation262 silent mutations from native hNKCC1PromoterCMVAvailable SinceNov. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
VE-cad KI gRNA2
Plasmid#92311PurposeCRISPR-GFP-gRNA for cutting VEcadDepositorAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJZC74
Plasmid#62342PurposesgRNA + 1x COM with COM-KRAB effector for mammalian cellsDepositorInsertssgRNA + 1x COM binding module
COM-KRAB
UseLentiviralTagsKRABExpressionMammalianMutationTargets sv40 promoter, sequence: GAATAGCTCAGAGGCC…PromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pIDK-HDAC1fl
Plasmid#109158PurposeEncodes human full-length HDAC1 to be expressed in a baculovirus/insect cell expression systemDepositorInserthuman full-length HDAC1, sequence-optimized for insect cells (HDAC1 Human)
ExpressionInsectPromoterp10Available SinceJan. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
Nrp1-Fc-His
Plasmid#72097PurposeExpresses the extracellular region of the Neuropilin 1 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-FLAG-CXCR4
Plasmid#98947PurposeMammalian expression plasmid for N-terminal FLAG-tagged human CXCR4DepositorInsertCXCR4 (CXCR4 Human)
TagsFLAG (dykdddd) epitope tag and Signal/leader sequ…ExpressionMammalianMutationFull-length, wildtypePromoterCMVAvailable SinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pUB-HspINTBxb1
Plasmid#127519PurposePlasmid encodes H. sapiens codon optimized Integrase Bxb1.DepositorInsertIntegrase Bxb1 coding sequence codon optimized for H. sapiens expression.
ExpressionMammalianAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
hCCR5-mTFP1
Plasmid#110193PurposeEncodes for human CCR5 coding sequence tagged with the mTFP1 FPDepositorAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBUN6I11
Plasmid#50580PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-KRAB, gRNA scaffold for insertion of target sequence (OsU3 promoter), Bar resistanceDepositorInsertsdCas9-KRAB
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG, HA, and NLSMutationdCas9 that is defective in DNA cleavage; the maiz…PromoterOsU3p and Ubi1pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pPICZ-pre-pro-alphaf(I)-E2-Crimson
Plasmid#117660PurposeTest intracellular localisation of E2-Crimson and study the secretion efficiencyDepositorInsertpre-pro-alphaf(I)-E2-Crimson
ExpressionYeastMutationThis plasmid encodes the fluorescent protein E2-C…PromoterpAOX1Available SinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHSN501
Plasmid#50589PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses zCas9D10A, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInsertszCas9D10A
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG and NLSMutationCas9D10A nickase, was derived from the zCas9 and …Promoter2×35Sp and AtU6-26pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
p2R3a-Tq2CFP-OcsT
Plasmid#71268PurposeEntry clone containing Turqoise2. Can be fused with linker to the C-terminal end of protein of interest. For use in plants and compatible with the MultiSite Gateway systemDepositorInsertTq2CFP
UseGatewayTags4xGly linker and octaline synthase terminatorAvailable SinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV -HA-Luciferase
Plasmid#227802Purposeexpressing HA tag and the coding sequence of luciferase by the constitutive CMV promoterDepositorInsertHA-Luciferase
UseAAVPromoterCMVAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-CXCR4
Plasmid#98946PurposeMammalian expression plasmid for N-terminal myc-tagged human CXCR4DepositorInsertCXCR4 (CXCR4 Human)
TagsSignal/leader sequence from Influenza A virus HA …ExpressionMammalianMutationFull-length, wildtypePromoterCMVAvailable SinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
Plxna2-Fc-His
Plasmid#72123PurposeExpresses the extracellular region of the PlexinA2 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a_CRATES
Plasmid#176251PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and type IIS restriction site for endonuclease BaeI at the crRNA region that facilitates the generation of mulitplDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
EGFP-Tau(T217A)
Plasmid#187025PurposeExpresses EGFP tagged human 2N4R tau (with T217A mutation) in mammalian cells with CMV promoterDepositorInsertMAPT (MAPT Human)
TagsEGFPExpressionMammalianMutationChanged Threonine 217 to AlaninePromoterCMVAvailable SinceJan. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV pCAG-mRuby3-WPRE
Plasmid#107744PurposeCan be used to express mRuby3. Can also be used to create adeno-associated virus for delivery of the mRuby3 sequence.DepositorInsertmRuby3
UseAAVExpressionMammalianPromoterCAGAvailable SinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
p2R3a-TagRFP-OcsT
Plasmid#71270PurposeEntry clone containing TagRFP. Can be fused with linker to the C-terminal end of protein of interest. For use in plants and compatible with the MultiSite Gateway systemDepositorInsertTagRFP
UseGatewayTags4xGly linker and octaline synthase terminatorAvailable SinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC34
Plasmid#62331PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 2x MS2(wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
EBA175-bio
Plasmid#47743PurposeExpresses enzymatically monobiotinylated full-length EBA175 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised EBA175
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMT-sox10-cytoBirA-2A-mCherry_Ras
Plasmid#80062PurposeSox10 promoter driving HA-tagged biotin ligase (BirA), a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA), a Thosea asigna virus peptide (2A), and mCherry protein
UseZebrafish biotaggingTags3x HAExpressionBacterialPromoterSox10 promoterAvailable SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only