We narrowed to 24,135 results for: CRISPR
-
Plasmid#121541PurposeExpresses a 6X-His tagged type II-C Cas9 from S. muelleri in bacterial cellsDepositorInsertSmuCas9
ExpressionBacterialAvailable SinceFeb. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKS7107
Plasmid#89051PurposeExpresses Nm crRNA, Nm tracrRNA and human codon-optimized NmCas9DepositorInsertsNm crRNA
Nm tracrRNA
hNmCas9
UseCRISPRTagsHA tag, NLS, and SV40 NLSPromoterEF1a and human U6Available SinceApril 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPPC001
Plasmid#171138PurposeFor integration of Sp.pCas9-dCas9 and BBa_J23107-MCP-SoxS(R93A/S101A) with miniTn7T methodDepositorInsertSp.pCas9-dCas9_BBa_J23107-MCP-SoxS(R93A, S101A)
UseCRISPRExpressionBacterialMutationSoxS has R93A and S101A mutationsPromoterSp.pCas9, BBa_J23107Available SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-i1 sgRNA / hSpCas9
Plasmid#172825PurposeMammalian expression of a sgRNA targeting the intron 1 position 1 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the intron 1 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330 _HITI donor B6
Plasmid#172847PurposeDRS-2 sgRNA expression under a U6 promotor and HITI donor B6 (Zhong et al, eLife 2021), mEGFP translational phase (1-1), excised by DRS-2 sgRNA (with SpCas9).DepositorInsertDRS-2 sgRNA and HITI donor (phase 1) encoding mEGFP
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCfB3039(XII-2 MarkerFree)
Plasmid#73279PurposeEasyClone-MarkerFree backbone vector for the addition of 1 or 2 genes and promoters for integration into site XII-2 (Chr XII: 808805..809939)DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-GFP-U6ac-rac2-guides
Plasmid#168241Purpose"neutrophil specific GFP with ubiquitous rac2 sgRNAs"DepositorInsertrac2 sgRNAs
UseCRISPRAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
pAAV-FLEXfrt-SaCas9-U6-sgGabrg1
Plasmid#124870PurposeMutagenesis of Gabrg1DepositorInsertGabrg1 (Gabrg1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-moxGFP-Puro-H2BC11-MMEJ
Plasmid#207760PurposeMMEJ donor template for moxGFP-2A-Puro insertion into the C-terminus of the H2BC11 locus for nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H2BC11 Addgene #207755DepositorInsertH2BC11 Short Homology Arms flanking a moxGFP-Puro Cassette (H2BC11 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
p1193-scAAV-U6-sgRNA_Nme2Cas9_Rosa26-CB-PI-AcrIIC3Nme_FLAG_NLS-3XmiR122BS
Plasmid#129531PurposeSelf-complementary AAV vector expressing Nme2Cas9 sgRNA targeting Rosa26 and AcrIIC3Nme with 3x miR-122 binding sites in 3' UTRDepositorInsertscodon-optimized AcrIIC3Nme
sgRNA_Rosa26
UseAAVTagsFLAG/NLSPromoterU6 and cytomegalovirus-enhancer chicken β-actin p…Available SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJZC625
Plasmid#62321PurposesgRNA with 1x MS2, Pol II promoter with ribozyme-gRNA-ribozyme design for yeast cellsDepositorInsertsgRNA +1x MS2, Pol II promoter with ribozyme cleavage
ExpressionYeastPromoterpAdhAvailable SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-GFP-U6ac-cdk2-guides
Plasmid#168250Purpose"neutrophil specific GFP with ubiquitous cdk2 sgRNAs"DepositorInsertcdk2 sgRNAs
UseCRISPRAvailable SinceMarch 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAcrF1
Plasmid#89233PurposePlasmid contains the gene for anti-CRISPR protein AcrF1 (gene 35 from bacteriophage JBD30), with N-terminal 6his tag and TEV protease cleavage siteDepositorInsertAcrF1
Tags6xHis-TEV and FLAGAvailable SinceApril 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCfB3036(XI-1 MarkerFree)
Plasmid#73274PurposeEasyClone-MarkerFree backbone vector for the addition of 1 or 2 genes and promoters for integration into site XI-1 (Chr XI: 67491..68573)DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgGabrg1
Plasmid#124856PurposeMutagenesis of Gabrg1DepositorInsertGabrg1 (Gabrg1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
-
pFETCh_FOXM1_iso1
Plasmid#135734PurposeDonor vector for 3' FLAG tag of human FOXM1_iso1DepositorAvailable SinceFeb. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330_rActb sgRNA / hSpCas9
Plasmid#172833PurposeMammalian expression of a sgRNA targeting the intron 1of rat Actb (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of rActb under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_rSyn1 sgRNA / hSpCas9
Plasmid#172840PurposeMammalian expression of a sgRNA targeting the intron 21 (last intron) of rSyn1 (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 21 of rSyn1 under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSHS273 - Bacterial expression plasmid for SpCas9∆REC3 variant
Plasmid#101202PurposeBacterial expression plasmid for SpCas9∆REC3 variantDepositorInsertSpCas9 variant M1–N497,GGS,V713–D1368
Tags10x His, MBP, and TEV siteExpressionBacterialMutationM1–N497, GGS, V713–D1368PromoterT7Available SinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-Cas9-GFP (gRNA: Ascl1-3)
Plasmid#159658PurposeCRISPR/Cas9 expressing plasmid containing the gRNA targeting mouse Ascl1.DepositorInserthSpCas9
UseCRISPRPromoterEf1aAvailable SinceMarch 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-Cas9-GFP (gRNA: Ascl1-2)
Plasmid#159657PurposeCRISPR/Cas9 expressing plasmid containing the gRNA targeting mouse Ascl1.DepositorInserthSpCas9
UseCRISPRPromoterEf1aAvailable SinceMarch 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJZC40
Plasmid#62334PurposesgRNA + 2x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 2x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJSC228 - Bacterial expression plasmid for SpCas9 Cluster 2 variant
Plasmid#101233PurposeBacterial expression plasmid for SpCas9 Cluster 2 variantDepositorInsertSpCas9 variant G582A/V583A/E584A/D585A/N588A
Tags10x His, MBP, and TEV siteExpressionBacterialMutationG582A, V583A, E584A, D585A and N588APromoterT7Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hNmeCas9-NLS(SV40)-3xFLAG (KAC409)
Plasmid#133790PurposeCAG promoter expression plasmid for human codon optimized NmeCas9 nuclease with C-terminal NLS (SV40)DepositorInserthuman codon optimized NmeCas9
TagsNLS(SV40)-3xFLAGExpressionMammalianMutationn/aPromoterCAGAvailable SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYPQ141-ZmUbi-RZ-Aa3.8.4
Plasmid#136375PurposeGateway entry clone for AaCas12b sgRNA expression under ZmUbi promoter with ribozyme processing; sgRNA scaffold 3.8 with MS2 at the third stem loop is usedDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceFeb. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
-