We narrowed to 14,706 results for: EGF
-
Plasmid#195101PurposeVector to introduce human CTCF cDNA tagged with eGFP and two AIDs in the cells. Blasticidin selection (2A-fusion). Auxin-inducible degron system.DepositorAvailable SinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pHAGE-IRES-puro-NLS-dHgm4Cas13b-EGFP-NLS
Plasmid#191360PurposeOverexpression of NLS-dHgm4Cas13b-EGFP-NLS in human cellsDepositorInsertNLS-dHgm4Cas13b-EGFP-NLS
TagsEGFPExpressionMammalianAvailable SinceOct. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-IRES-puro-NLS-dMisCas13b-EGFP-NLS
Plasmid#191359PurposeOverexpression of NLS-dMisCas13b-EGFP-NLS in human cellsDepositorInsertNLS-dMisCas13b-EGFP-NLS
TagsEGFPExpressionMammalianAvailable SinceOct. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
PylT(CTAG)WT PylS mCherry-P2A-eGFP(CTAG)
Plasmid#174527PurposeDual-fluorescence reporter for quantifying PylT(CTAG)WT decoding efficiencyDepositorInsertPylS
TagsFlagExpressionMammalianAvailable SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
C239-E02: attB2r-IRES-ffLuc2-eGFP-pA-attB3
Plasmid#162918PurposeGateway attB2r/attB3 entry clone for generation of polycistronic ffLuc2-eGFP reporter using an internal ribosome entry sequence (IRES)DepositorInsertfirefly luciferase/green fluorescent protein fusion with upstream IRES sequence
UseSynthetic BiologyAvailable SinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
mEGFP-N1 YAPS127A- L308/311/325/318E (4LE)
Plasmid#166466PurposeExpresses fusion of mEGFP and YAPS127A- L308/311/325/318E (4LE)DepositorInsertmEGFP, YAPS127A- L308/311/325/318E (4LE) (YAP1 Human)
ExpressionMammalianMutationYAPS127A- L308/311/325/318E (4LE)Available SinceApril 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRDAX-209 C-Tag miRFP670[2] L10 FRB EGFP
Plasmid#129894PurposePPI (BiFC/TriFC) assay vectorDepositorInsertFRB
ExpressionMammalianAvailable SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRDAX-336 N-Tag miRFP670[2] L32 {Esp3I(2x)} EGFP
Plasmid#129839PurposePPI (BiFC/TriFC) assay vectorDepositorInsertmiRFP670
ExpressionMammalianAvailable SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJET1.2[eb-Tc’bhsp-EGFP-2A-Cre; ye-3xP3-gTc’v-SV40]
Plasmid#124069PurposeCRISPR/Cas mediated knock-in via non-homologous end-joining in Tribolium; bhsp drives EGFP expression; Dm-ebony and Dm-yellow for linearization; (Transformation plasmid; Black eye marker)DepositorInserteb-Tc’bhsp-EGFP-2A-Cre; ye-3xP3-gTc’v-SV40
UseCRISPR and Cre/LoxExpressionInsectPromoterbhsp68Available SinceJuly 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
KA801: pMVP (L3-L2) HA tag + pA; CMV::eGFP-P2A-TETa-pA
Plasmid#121800PurposepMVP L3-L2 entry plasmid, contains HA tag-polyA + CMV-eGFP-P2A-TETa-polyA for 3- or 4-component MultiSite Gateway Pro assembly. Adds C-term HA tag to gene plus downstream CMV-driven GFP-P2A-TETaDepositorInsertHA epitope tag-polyA + CMV::eGFP-P2A-TETa-polyA
UseGateway Cloning and Synthetic BiologyAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α-FRT-FLEX-GtACR2-KA2N-EGFP
Plasmid#114378Purposeexpresses Flpo recombinase-dependent GtACR2-KA2N, which targets GtACR2 to the somatodendritic compartmentDepositorAvailable SinceAug. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBEST-p70a-UTR1-deGFP Y35TAG-6xHis-T500
Plasmid#92225PurposeExpression of deGFP mutant Y35TAG for ncAA incoporation using the p70a promoter and UTR1DepositorInsertdeGFP Y35TAG
UseSynthetic Biology; Cell free protein synthesis (c…Tags6xHisExpressionBacterialMutationResidue Y35 mutated into TAG (Amber) stop codon f…Promoterp70aAvailable SinceOct. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBEST-p15A-OR2-OR1-Pr-UTR1-deGFPT500 (121p)
Plasmid#70197PurposePromoter panelDepositorInsertdeGFP
Available SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCru5-ACC/ACC/ACC-mEGFP-IRES-mCherry
Plasmid#49219PurposeRetroviral expression vector. Contains an altered Kozak sequence and/or upstream open reading frames to modulate expression at the level of translation.DepositorInsertsmEGFP
mCherry
UseRetroviral and Synthetic BiologyTagsSfuI site to create C-terminal fusionsExpressionMammalianPromoterViral LTR (or CMV)Available SinceDec. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
EGFP G protein Gamma 3(A73L,L74I,L75S) in pcDNA3.1
Plasmid#42190DepositorInsertG protein Gamma 3(A73L,L74I,L75S) (Gng3 Mouse)
TagsEGFPExpressionMammalianMutationA73L,L74I,L75SPromoterCMVAvailable SinceMarch 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
pJEP323-pAAV-FullH1TO-SaCa9gRNAi(SapI)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA Empty Cassette
Plasmid#113700PurposeDox-inducible H1 driven SaCas9 gRNA expression cassette without a gRNA. Followed by an EFS driven GFP-KASH in a separate reading frame. SapI can be used to clone in a gRNAs.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pc5139-pEGFP-H3.1-K36M
Plasmid#241430PurposeExpresses human Histone H3.1 as fusion to GFP with lysine to methionine point mutation of K36 from plasmid H3.1 using primers: forward: ACCGGTGGCGTGATGAAACCTCATCGC & reverse: GCGATGAGGTTTCATCDepositorInserthuman Histone H3.1 (H3C1 Human)
TagsEGFPExpressionMammalianMutationlysine at position 36 to methionine (K36M)PromoterCMVAvailable SinceJune 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
mCherry-TOP1-GFP-pEGFP-N1
Plasmid#238377PurposeExpresses mCherry-DNA Topoisomerase 1-GFP in mammalsDepositorAvailable SinceMay 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS_internal PA-TubA1A-IRES-EGFP
Plasmid#255804Purposemammalian expression of PA-tagged human TubA1A(E254A). The PA tag (GVAMPGAEDDVV) is inserted between Ile42 and Gly43 in the flexible loop of TubA1A. An IRES drives expression of EGFP reporter.DepositorAvailable SinceMay 18, 2026AvailabilityAcademic Institutions and Nonprofits only -
AAV-Gfa2-VIVIT-EGFP
Plasmid#254430PurposeFor production of AAV containing VIVT-EGFPDepositorInsertVIVIT-Green Fluorescent Protein
UseAAVPromoterGfa2Available SinceMay 18, 2026AvailabilityAcademic Institutions and Nonprofits only