-
Plasmid#226955PurposeABEmax plasmid enabling A:T to G:C base editing using a single plasmid.DepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only
-
CROPseq-puro-v2
Plasmid#127458PurposeEntry plasmid for guide cloningDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceJuly 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
OgeuIscB ωRNA-v2
Plasmid#220958Purposehuman U6-driven expression of ωRNA-v2 scaffold with BsmBI for guide cloingDepositorInsertOgeuIscB-ωRNA-v2 scaffold with BsmBI for guide cloning
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
enOgeuIscB with ωRNA-v2
Plasmid#220939PurposeCMV-driven expression of enOgeuIscB and human U6-driven expression of ωRNA-v2 scaffold with BsmBI for guide cloingDepositorInsertsCMV-SV40 NLS-enOgeuIscB_nucleoplasmin NLS
OgeuIscB-ωRNA-v2 scaffold with BsmBI for guide cloning
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-v2-ALDH1A3gRNA2
Plasmid#189747PurposeThe construct was used for expression of gRNA and Cas9 for knocking out of the ALDH1A3 gene.DepositorInsertCas9, ALDH1A3 gRNA
UseCRISPRTagsExpressionMutationPromoterU6Available sinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-v2-ALDH1A3gRNA1
Plasmid#189746PurposeThe construct was used for expression of gRNA and Cas9 for knocking out of the ALDH1A3 gene.DepositorInsertCas9, ALDH1A3 gRNA
UseCRISPRTagsExpressionMutationPromoterU6Available sinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
RPS4X sgRNA-3 lentiCRISPR v2-Blast plasmid
Plasmid#192233Purposelentiviral vector expressing sgRNA-3 targeting eIF3 binding site of RPS4X 5'UTRDepositorInsertsgRNA-3 targeting eIF3 binding site of RPS4X 5'UTR (RPS4X Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
RPS15A sgRNA-5 lentiCRISPR v2-Blast plasmid
Plasmid#192230Purposelentiviral vector expressing sgRNA-5 targeting eIF3 binding site of RPS15A 5'UTRDepositorInsertsgRNA-5 targeting eIF3 binding site of RPS15A 5'UTR (RPS15A Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
RPS4X sgRNA-4 lentiCRISPR v2-Blast plasmid
Plasmid#192234Purposelentiviral vector expressing sgRNA-4 targeting eIF3 binding site of RPS4X 5'UTRDepositorInsertsgRNA-4 targeting eIF3 binding site of RPS4X 5'UTR (RPS4X Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
RPS15A sgRNA-4 lentiCRISPR v2-Blast plasmid
Plasmid#192229Purposelentiviral vector expressing sgRNA-4 targeting eIF3 binding site of RPS15A 5'UTRDepositorInsertsgRNA-4 targeting eIF3 binding site of RPS15A 5'UTR (RPS15A Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
U6-AsCas12f-sgRNA-v2
Plasmid#204639PurposeExpression of trancated AsCas12f sgRNA in mammalian cellsDepositorInserttrancated AsCas12f sgRNA (sgRNA-v2)
UseTagsExpressionMammalianMutationPromoterU6Available sinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pH-nCas9-PPE-V2
Plasmid#170131PurposeFor plant prime editing in rice plants or monocotyledons protoplastsDepositorInsertnCas9(H840A)-M-MLV
UseCRISPRTagsExpressionPlantMutationH840A for Cas9; D200N, T306K, W313F, T330P and L…Promotermaize Ubiquitin-1, OsU3Available sinceMay 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…PromoterAvailable sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC57kan-T7-gRNA-U6 V2
Plasmid#115520PurposeTo construct multiple sgRNA expression vector for CRISPRDepositorInsertsgRNA scaffolf-U6 promoter
UseCRISPRTagsExpressionMutationPromoterAvailable sinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
EFS-SpdCas9-Dnmt3A/3L-V2
Plasmid#222499PurposeExpresses EFS promoter driven human codon optimized SpdCas9 directly fused to Dnmt3A/3L variant V2 (E814G) followed by P2A-mCherryDepositorInsertS. pyogenes dCas9 with C-terminal fusion of murine Dnmt3A-Dnmt3L variant V2 (E814G) engineered fusion
UseLentiviralTagsFLAG TagExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9; E814G in Dnmt3APromoterEFSAvailable sinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE3GV-SpdCas9-Dnmt3A/3L-V2
Plasmid#222505PurposeExpresses TRE3GV promoter driven human codon optimized SpdCas9 directly fused to Dnmt3A/3L variant V2 (E814G) and hPGK promoter driven mCherryDepositorInsertsS. pyogenes dCas9 with C-terminal fusion of murine Dnmt3A-Dnmt3L variant V2 (E814G) engineered fusion
mCherry
UseLentiviralTagsFLAG TagExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9; E814G in Dnmt3APromoterTRE3GV and hPGKAvailable sinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDY0663 ACTB atgRNA with v2 scaffold
Plasmid#179108PurposeACTB N-term PBS 13 RT 29 Bxb1 AttB 46 atgRNA with v2 scaffoldDepositorInsertACTB N-term PBS 13 RT 29 AttB 46 atgRNA with v2 scaffold
UseCRISPRTagsExpressionMutationPromoterAvailable sinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP185 pLVP-dCas9-DNMT3a V2
Plasmid#100936PurposedCas9 and DNMT WT on C terminus, 4 NLS, driven by pGK promoter, with P2A site and PURO gene, within a lentiviral transfer backboneDepositorInsertdCas9, DNMT3a catalytic domain (DNMT3A Human, S.pyogenes)
UseCRISPR and LentiviralTags3xHA and 3xTy1ExpressionMammalianMutationD10A, H840A for dCas9PromoterAvailable sinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-multi-v2-Puro-BsmBI_entry (pRW1484)
Plasmid#225752PurposeEntry vector to clone sgRNA(s) into the CROPseq-multi-v2 construct with Puromycin resistance; v2 is compatible with T7 in vitro transcription detectionDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceSept. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-multi-v2-Zeo-BsmBI_entry (pRW1500)
Plasmid#225753PurposeEntry vector to clone sgRNA(s) into the CROPseq-multi-v2 construct with Zeocin resistance; v2 is compatible with T7 in vitro transcription detectionDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceSept. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
V2-MESA-35F-M-dCas9
Plasmid#84506PurposeMESA target chain with V2-MESA ectodomain, 35 extracellular linkers, a flag tag, M cleavage sequence, and dCas9-VP64DepositorInsertV2-MESA-35F-M-dCas9
UseLentiviralTagsFlagExpressionMammalianMutationPromoterCMVAvailable sinceJan. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
CROP-seq-copGFP-v2-no-scaffold
Plasmid#228520PurposeCROP-seq-puro-v2 with scaffold sequence removed for the insertion of CRISPRmap Opool with guide, scaffold and barcode sequences, using copGFP as selection markerDepositorTypeEmpty backboneUseLentiviralTagsExpressionMutationPromoterAvailable sinceJan. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
CROP-seq-puro-v2-no-scaffold
Plasmid#228521PurposeCROP-seq-puro-v2 with scaffold sequence removed for the insertion of CRISPRmap Opool with guide, scaffold and barcode sequencesDepositorInsertsUseLentiviralTagsExpressionMutationPromoterAvailable sinceJan. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
CROP-seq-mTurquoise2-v2-no-scaffold
Plasmid#228522PurposeCROP-seq-puro-v2 with scaffold sequence removed for the insertion of CRISPRmap Opool with guide, scaffold and barcode sequences, using mTurquoise2 as selection markerDepositorInsertmTurquoise2
UseLentiviralTagsExpressionMutationPromoterAvailable sinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-multi-v2-palmitoyl-mTagBFP2-BsmBI_entry (pRW1509)
Plasmid#225755PurposeEntry vector to clone sgRNA(s) into the CROPseq-multi-v2 construct with membrane-localized palmitoyl-mTagBFP2; v2 is compatible with T7 in vitro transcription detectionDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceSept. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-multi-v2-mTagBFP2-NLS-BsmBI_entry (pRW1506)
Plasmid#225754PurposeEntry vector to clone sgRNA(s) into the CROPseq-multi-v2 construct with nuclear-localized mTagBFP2-NLS; v2 is compatible with T7 in vitro transcription detectionDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceSept. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6(gDmap1 v2)-PGK-Puro-BFP
Plasmid#117141PurposeExpress gRNA vs Dmap1DepositorInsertgDmap1 v2 (Dmap1 Synthetic)
UseCRISPR and LentiviralTagsExpressionMutationDeleted BbsI site within WPRE, modified BFPPromoterhuman U6 promoter, mouse PGK promoterAvailable sinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1180 U6-reci Gag-pol v2
Plasmid#201915PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and sgRNA (human U6 promoter. BsmBI cutsites for spacer insertion)DepositorInsertGag-pol
UseTagsExpressionMammalianMutationPromoterCAGAvailable sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1179 U6-reci Gag-Cas9 v2
Plasmid#201914PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and sgRNA (human U6 promoter. BsmBI cutsites for spacer insertion)DepositorInsertGag-Cas9 v2
UseTagsExpressionMammalianMutationPromoterCAGAvailable sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-multi-v2-SpCas9-P2A-Puro-BsmBI_entry (pRW1512)
Plasmid#225756PurposeEntry vector to clone sgRNA(s) into the CROPseq-multi-v2 construct with expression of SpCas9 and Puromycin resistance; v2 is compatible with T7 in vitro transcription detectionDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceSept. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
UseTagsExpressionMammalianMutationPromoterCAG and Human U6Available sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
UseTagsExpressionMammalianMutationPromoterCAG and Human U6Available sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR_mCherry
Plasmid#229078PurposeSmall lentiviral backbone for CRISPR guide libraries, improved titre for hard to transduce cellsDepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterEF1sAvailable sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_ZsG gRNA_4
Plasmid#192688PurposeLentiviral expression of Cas9 and ZsGreen1 targeting sgRNADepositorInsertCas9, ZsGreen targeting sgRNA #4
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1a, U6Available sinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_ZsG gRNA_1
Plasmid#192685PurposeLentiviral expression of Cas9 and ZsGreen1 targeting sgRNADepositorInsertCas9, ZsGreen targeting sgRNA #1
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1a, U6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_ZsG gRNA_2
Plasmid#192686PurposeLentiviral expression of Cas9 and ZsGreen1 targeting sgRNADepositorInsertCas9, ZsGreen targeting sgRNA #2
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1a, U6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_ZsG gRNA_3
Plasmid#192687PurposeLentiviral expression of Cas9 and ZsGreen1 targeting sgRNADepositorInsertCas9, ZsGreen targeting sgRNA #3
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1a, U6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2 RFP670
Plasmid#187646Purposelentiviral vector expressing RFP670 alongside Cas9 and an sgRNA cloning siteDepositorInsertRFP 670
UseLentiviralTagsRFP670 and sgRNA cloning siteExpressionMutationPromoterEFS (P2A)Available sinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_PROX1_1+3
Plasmid#121176PurposeLentiviral construct for the expression of Cas9 protein and puromycin resistance from EFS promoter and two guide RNAs targeting for deletion PROX1 start codon sequence.DepositorInsertCas9-P2A-puro and U6 promoters driven expression of gRNAs
UseCRISPR and LentiviralTagsP2A-puroExpressionMammalianMutationPromoterAvailable sinceJuly 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_PROX1_1+4
Plasmid#121177PurposeLentiviral construct for the expression of Cas9 protein and puromycin resistance from EFS promoter and two guide RNAs targeting for deletion PROX1 start codon sequence.DepositorInsertCas9-P2A-puro and U6 promoters driven expression of gRNAs
UseCRISPR and LentiviralTagsP2A-puroExpressionMammalianMutationPromoterAvailable sinceMarch 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR.v2.TetON_Cas13d_U6_DR
Plasmid#196727PurposeSortable and selectable, Tet-inducible RfxCas13d with guide cassette (one vector system). Inducible knock-down.DepositorInsertRfxCas13d-T2A-miRFP670nano
UseCRISPR and LentiviralTagsNucleoplasmin NLS and SV40 NLSExpressionMutationPromoterTREAvailable sinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2R
Plasmid#167932PurposelentiCRISPRv2 variant with mScarlet-I fluorescence marker.DepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6, EF1aAvailable sinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-Opti
Plasmid#163126PurposeLentiCRISPRv2 variant with modified sgRNA scaffold from Chen et al. 2013 Cell.DepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceFeb. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-Blast-mU6
Plasmid#206806PurposepLentiCRISPRv2 variant with mU6 promoter driving the sgRNA, and a Blasticidin resistance cassetteDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromotermU6Available sinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
lenticrispr-wt-ltr-puro
Plasmid#173428PurposeExpresses Cas9 and guide RNA, contains intact LTRDepositorInsertS. pyogenes sgRNA cassette
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
p8389 LentiCRISPRv2 Neo sgNT-1
Plasmid#221649PurposeExpression of non-targeting control sgRNADepositorInsertnon-targeting sgNT-1
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceSept. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
p8390 LentiCRISPRv2 Neo sgNT-2
Plasmid#221650PurposeExpression of non-targeting control sgRNADepositorInsertnon-targeting sgNT-2
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceSept. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
sgCtr- LentiCRISPRv2
Plasmid#107402PurposeLentiviral expression of Cas9 and a control gRNADepositorInsertcontrol gRNA
UseLentiviralTagsExpressionMutationPromoterAvailable sinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-V2_mMSH2
Plasmid#186156PurposesgRNA targeting murine Msh2 geneDepositorInsertMsh2_gRNA (Msh2 Mouse)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJuly 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-bleo-ErbB4
Plasmid#197353PurposeA knock-out vector for dog ErbB4.DepositorInsertA gRNA targeting the dog ERBB4 gene and the cDNA of CRISPR-Cas9
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only