We narrowed to 26,082 results for: gfp gene
-
Plasmid#65278Purposesynchronize trafficking of TNF from the ER (RUSH system)DepositorInsertTNF (TNF Human)
TagsEGFP and Streptavidin Binding Protein (SBP)ExpressionMammalianPromoterCMVAvailable SinceJune 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
lenti-25xAARE-minP-EGFP
Plasmid#159666PurposeEGFP reporter plasmid containing 25 tandem repeats of the amino acid response element (AARE)DepositorInsert25xAARE-minP-EGFP
UseLentiviralExpressionMammalianAvailable SinceMarch 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-TRE-MA4-GFP
Plasmid#114380PurposeDoxycycline inducible MLL-AF4 and GFP expression. The construct has been used with CAG-rtTA for making engraftable iPSC derived HSCs.DepositorAvailable SinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-HDR-mEGFP-camk2a
Plasmid#104589PurposeAAV vector including gRNA expression cassette and mEGFP knock-in donor targeting mouse camk2aDepositorInsertcalcium/calmodulin-dependent protein kinase II alpha (Camk2a Mouse)
UseAAV, CRISPR, and Mouse TargetingPromoterNoneAvailable SinceDec. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-Bi-gePSI-pCamk2a-AcGFP
Plasmid#133732PurposeExpresses both the gePSI-α-chain and the gePSI-β-chain under control of the inducible bi-directional TRE3G promoter. Expresses constitutively AcGFP under control of a Camk2a promoter.DepositorInsertsgePSI-β-chain
gePSI-α-chain
AcGFP1
UseAAVTagsmurine ornithine decarboxylase - degron (ODC36)ExpressionMammalianPromoterpCamk2a and pTRE3G-BiAvailable SinceDec. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pICE-EGFP-FLAG-PSMD2
Plasmid#161917PurposeExpresses human PSMD2 with a N-terminal GFP-FLAG tag. Confers Puromycin resistance. Inducible in T-REx cells.DepositorInsert26S proteasome non-ATPase regulatory subunit 2 (PSMD2 Human)
TagsGFP-FLAGExpressionMammalianPromoterCMVAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRIP-SFFV-EGFP-NLS
Plasmid#86677PurposeExpresses nuclear-localized GFP after lentiviral transduction. Can be used to monitor GFP leakage into the cytosol following nuclear envelope rupture events.DepositorInsertEGFP-NLS
UseLentiviralAvailable SinceApril 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-EGFP-Rac1-Q61L
Plasmid#12981DepositorInsertRac1 constitutively active (RAC1 Human)
TagsEGFPExpressionMammalianMutationQ61L Constitutively activeAvailable SinceOct. 27, 2006AvailabilityAcademic Institutions and Nonprofits only -
AAV Ef1a-EGFP-WPRE
Plasmid#135428PurposeCan be used to express EGFP. Can also be used to create adeno-associated virus for delivery of the EGFP sequenceDepositorInsertEGFP
UseAAVExpressionMammalianPromoterEF1aAvailable SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pT3-Neo-EF1a-GFP
Plasmid#69134PurposeSleeping Beaquty (SB) vector encoding G418 resistance and GFP from two separate promotersDepositorTypeEmpty backboneUseSleeping beauty transposonExpressionMammalianPromoterU3MSCVAvailable SinceJan. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHR-flag-GFP-iCAM-1
Plasmid#205186PurposeThis vector encodes of a synCAM (iCAM1) and GFPDepositorInsertsynCAM iCAM1 and GFP
UseLentiviralExpressionMammalianAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
EFSp-GFP-YAP (5SA)
Plasmid#174170PurposeLentiviral vector to constitutively express overactive YAP (5 LATS phosporylation sites mutated to Ala) under control of the EFS promoter.DepositorInsertYAP (YAP1 Human)
UseLentiviralTags3x FLAG tagExpressionMammalianMutationFive LATS phosphorylation sites (S61, S109, S127,…PromoterEFSAvailable SinceSept. 28, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
IRE1-2EGFP-ter-kanMX4
Plasmid#184766PurposeIntegration of 2xGFP tag at IRE1 C terminus. Potential indicator of UPR activation. Uses antibiotic resistance marker kanMX4.DepositorAvailable SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGCDNsam-Hnf4a-IRES-GFP
Plasmid#33006DepositorInserthepatic nuclear factor 4 alpha (Hnf4a Mouse)
UseRetroviralAvailable SinceMarch 6, 2012AvailabilityAcademic Institutions and Nonprofits only -
pICE-EGFP-FLAG-PLIN3
Plasmid#161918PurposeExpresses human PLIN3 with a N-terminal GFP-FLAG tag. Confers Puromycin resistance. Inducible in T-REx cells.DepositorAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPyCAG-EGFP-TM-IRES-Pac
Plasmid#183603PurposeMammalian expression vector for membrane-tethered EGFP from the CAG promoter. Confers puromycin resistance.DepositorInsertEGFP-TM
TagsHuman PDGFRB transmembrane domain and Mouse IgGK …ExpressionMammalianPromoterCAGAvailable SinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pC28-LIC-sfGFP-His
Plasmid#165479PurposepET based vector for protein expression in E.coli for targets fused with C-terminal superfolder GFP and His tagDepositorTypeEmpty backboneTagsTEV-GFP-6xHisExpressionBacterialAvailable SinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-CMV-EGFP-Hygro
Plasmid#184593PurposeEGFPDepositorInsertEGFP
UseLentiviralPromoterCMVAvailable SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-eGFP-PC1-3HA
Plasmid#108406PurposeCan be used to generate stable Flp-In cells with tetracycline-inducible human PC1 expression.DepositorAvailable SinceAug. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only