We narrowed to 394 results for: Superfolder GFP
-
Plasmid#240226PurposeGateway entry clone with TurboID tagged with superfolder GFP (contains stop codon)DepositorInsertsfGFP-TurboID
UseGateway shuttle vectorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
Cx26-msfGFP
Plasmid#69016PurposeExpresses rat Cx26 (Gjb2 CDS) with a 7 amino acid linker on the C-terminus of the Connexin linking to monomerized superfolder Green Fluorescent Protein. Expression driven by CMV promoter.DepositorAvailable SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
Cx43K258stop-msfGFP
Plasmid#69023PurposeExpresses rat Cx43 (Gja1 CDS) truncated at amino acid 258 and tagged with msfGFP on the C-terminus. CMV promoter.DepositorInsertCx43 (Gja1 Rat)
TagsV206K monomerized super folder GFPExpressionMammalianMutationdelete codons 258-381 and fuse in frame to monome…PromoterCMVAvailable SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET28-sfGFP-DogTag Loop A
Plasmid#171779PurposeExpresses in bacterial cytoplasm superfolder GFP with DogTag and flanking linkers between Val22 and Asn23DepositorInsertsfGFP-DogTag Loop A
TagsHis6ExpressionBacterialMutationDogTag and linkers inserted between residues Val2…PromoterT7Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
BAS286 C terminal SF-GFP hygBR
Plasmid#74081PurposeS.pombe recoded superfolder GFP in universal C-terminal tagging plasmid, hygB resistancDepositorInsertsuper-folder GFP
Available SinceAug. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET28-sfGFP-DogTag Loop B
Plasmid#171780PurposeExpresses in bacterial cytoplasm superfolder GFP with DogTag and flanking linkers between Asp102 and Asp103DepositorInsertsfGFP-DogTag Loop B
TagsHis6ExpressionBacterialMutationDogTag and linkers inserted between residues Asp1…PromoterT7Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28-sfGFP[D134TAG+N150TAA]
Plasmid#164582Purposesuperfolder GFP with D134TAG and N150TAA mutationsDepositorInsertsfGFP-134TAG+150TAA
Tags6xHisExpressionBacterialMutationD134TAG + N150TAA MutationsPromoterT7Available SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET28-sfGFP-SpyTag003 Loop A
Plasmid#171776PurposeExpresses in bacterial cytoplasm superfolder GFP with SpyTag003 and flanking linkers between Val22 and Asn23DepositorInsertsfGFP-SpyTag003 Loop A
TagsHis6ExpressionBacterialMutationSpyTag003 and linkers inserted between residues V…PromoterT7Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28-sfGFP-DogTag Loop C
Plasmid#171781PurposeExpresses in bacterial cytoplasm superfolder GFP with DogTag and flanking linkers between Asp173 and Gly174DepositorInsertsfGFP-DogTag Loop C
TagsHis6ExpressionBacterialMutationDogTag and linkers inserted between residues Asp1…PromoterT7Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28-sfGFP-SpyTag003 Loop B
Plasmid#171777PurposeExpresses in bacterial cytoplasm superfolder GFP with SpyTag003 and flanking linkers between Asp102 and Asp103DepositorInsertsfGFP-SpyTag003 Loop B
TagsHis6ExpressionBacterialMutationSpyTag003 and linkers inserted between residues A…PromoterT7Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28-sfGFP-SpyTag003 Loop C
Plasmid#171778PurposeExpresses in bacterial cytoplasm superfolder GFP with SpyTag003 and flanking linkers between Asp173 and Gly174DepositorInsertsfGFP-SpyTag003 Loop C
TagsHis6ExpressionBacterialMutationSpyTag003 and linkers inserted between residues A…PromoterT7Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJL1-sfGFP-AQNAT
Plasmid#198211PurposepJL1 plasmid encoding superfolder GFP modified at the C-terminus with 30 amino acids containing a non-permissible AQNAT sequon followed by a 6x-His tagDepositorInsertsfGFP_AQNAT
Tags6x His Tag and AQNAT mutated (non-permissible) gl…ExpressionBacterialPromoterT7Available SinceMay 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJL1-sfGFP-MOOR
Plasmid#198212PurposepJL1 plasmid encoding superfolder GFP modified at the C-terminus with 32 amino acids containing the minimum optimal O-linked recognition site (MOOR) followed by a 6x-His tagDepositorInsertsfGFP_MOOR
Tags6x His Tag and MOOR glycosylation tagExpressionBacterialPromoterT7Available SinceMay 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJL1-sfGFP-MOORmut
Plasmid#198213PurposepJL1 plasmid encoding superfolder GFP modified at the C-terminus with 32 amino acids containing a non-permissible minimum optimal O-linked recognition site (MOORmut) followed by a 6x-His tagDepositorInsertsfGFP_MOORmut
Tags6x His Tag and mutated (non-permissible) MOORmut …ExpressionBacterialPromoterT7Available SinceMay 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUS252
Plasmid#127674PurposeExpresses fuGFP constitutively in E.coli cells. Designed to act as modular template for cutting out or amplifying fuGFP to place in other plasmid backbonesDepositorInsertFree Use GFP (fuGFP)
ExpressionBacterialPromoterlacAvailable SinceJune 24, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pRMC2-sec:msfGFP
Plasmid#194914PurposeTetracycline inducible expression of msfGFP fused to Sec signal peptide in StaphylococciDepositorInsertShine Dalgarno sequence followed by Sec signal peptide fused to monomeric superfolder GFP
UseTetracycline-inducible expression vector for stap…ExpressionBacterialAvailable SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
Cx30-msfGFP
Plasmid#69019PurposeExpresses human Cx30 (GJB6 CDS) with a 7 amino acid linker on the C-terminus of the Connexin linking to monomerized superfolder Green Fluorescent Protein. Expression driven by CMV promoter.DepositorAvailable SinceOct. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRMC2-tat:msfGFP
Plasmid#194915PurposeTetracycline inducible expression of msfGFP fused to Tat signal peptide in StaphylococciDepositorInsertShine Dalgarno sequence followed by Tat signal peptide fused to monomeric superfolder GFP
UseTetracycline-inducible expression vector for stap…ExpressionBacterialAvailable SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
psfGFP-LAMP1-mCherry (pHLARE)
Plasmid#164477PurposeLysosomal pH biosensor consisting of sfGFP-rat Lamp1-mCherry.DepositorAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-GFP-PQRv3-RFP
Plasmid#73951PurposeProtein Quantitation Reporter (PQR) to quantify a protein of interest in mammalian cells.DepositorInsertssfGFP (superfolder GFP)
RFP
TagsA residual PQR peptide wii be left at the C-termi…ExpressionMammalianPromoterChicken beta actin and Chicken beta actin (shared…Available SinceJan. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLei-sfGFP-V2*D134*Y152*
Plasmid#191112PurposeAn E. coli sfGFP reporter with two TAG at positions 2 & 134 & 152DepositorInsertsuperfolder green fluorescence protein
TagsHis tagExpressionBacterialMutationchanging V2 & D134 & Y152 to TAGAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLQ5079_pHR_PGK_sfGFP_CoV-F1
Plasmid#155303PurposeSARS-CoV-2 fluorescent reporter 1DepositorInsertSuperfolder GFP fused with SARS-CoV-F1 (ORF1ab Synthetic)
UseLentiviralExpressionMammalianPromoterPGKAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
TfR-sfGFP-myc tag-SpyCatcher003
Plasmid#133451PurposeExpresses SpyCatcher003 for display at the cell surface of mammalian cells, with superfolder GFP for visualization and myc tag for antibody detectionDepositorInsertTfR-sfGFP-myc tag-SpyCatcher003
TagsGSSGS and myc tagExpressionMammalianMutationContains C20 and A23 mutations that improve plasm…PromoterCMVAvailable SinceDec. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti sfGFP-LAMP1-mCherry (pHLARE)
Plasmid#164478PurposeLysosomal pH biosensor consisting of sfGFP-rat Lamp1-mCherry. Plasmid for lentivirus production.DepositorInsertLAMP1 (Lamp1 Rat)
UseLentiviralTagsmCherry and superfolder GFPExpressionMammalianPromoterCMVAvailable SinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUSE-URA3-Sec7-msYFP2
Plasmid#218969PurposeGene replacement plasmid to label S. cerevisiae Sec7 with msYFP2DepositorAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUS252y
Plasmid#191834PurposeExpresses fuYFP constitutively in E.coli cells. Designed to act as modular template for cutting out or amplifying fuYFP to place in other plasmid backbones.DepositorInsertfuYFP
ExpressionBacterialAvailable SinceJan. 17, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUS252L
Plasmid#191832PurposeExpresses fuBFP constitutively in E.coli cells. Designed to act as modular template for cutting out or amplifying fuBFP to place in other plasmid backbonesDepositorInsertfuBFP
ExpressionBacterialAvailable SinceJan. 17, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUS252b
Plasmid#191831PurposeExpresses fuGFPb constitutively in E.coli cells. Designed to act as modular template for cutting out or amplifying fuGFPb to place in other plasmid backbonesDepositorInsertfuGFPb
ExpressionBacterialAvailable SinceJan. 17, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUS252s
Plasmid#191833PurposeExpresses fuGFPs constitutively in E.coli cells. Designed to act as modular template for cutting out or amplifying fuGFPs to place in other plasmid backbonesDepositorInsertfuGFPs
ExpressionBacterialAvailable SinceJan. 17, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUSE-URA3-Sec7-mEYFP
Plasmid#218968PurposeGene replacement plasmid to label S. cerevisiae Sec7 with mEYFPDepositorAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUSE-URA-Sec7-mGold
Plasmid#218967PurposeGene replacement plasmid to label S. cerevisiae Sec7 with mGoldDepositorAvailable SinceSept. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET22b-T5-sfGFP*-XcP4H-MH4R
Plasmid#178043PurposeExpress green fluorescent protein with TAG at 151 position and enzymes to biosynthesize 5HTPDepositorInsertssuperfolder green fluorescent protein with TAG at 151 position
XcP4H with W179F mutation
dihydropterine reductase from human
pterin-4a-carbinolamine dehydratase from human
TagsHis tagExpressionBacterialAvailable SinceApril 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pY71-PT7-RiboJ-sfGFP-MGapt
Plasmid#129119PurposeExpresses a fluorescent reporter for the quantification of cell-free protein expression.DepositorInsertSuperfolder GFP with Malachite Green aptamer
UseSynthetic BiologyTagsHis6 and RiboJ InsulatorExpressionBacterialPromoterT7Available SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pB6-Cdk6-T2A-td-sfGFP-FNF-TK
Plasmid#134321PurposeB6J Cdk6-T2A-td-sfGFP allele targeting vector, low copy numberDepositorInsertCdk6 (Cdk6 Mouse)
UseMouse TargetingTagsC-terminal fusion of T2A-tandem dimer-superfolder…Available SinceMarch 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pENTR_BIP-sfGFP-TurboID-KDEL
Plasmid#240223PurposeGateway entry clone with ER-localized TurboID tagged with superfolder GFP (contains stop codon)DepositorInsertBIP-sfGFP-TurboID-KDEL
UseGateway shuttle vectorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR-scFv-GCN4-sfGFP-GB1-NLS-iLID-dWPRE
Plasmid#121966PurposeExpresses fusion of single chain variable fragment recognizing SunTag, fluorescent protein sfGFP, and iLID which upon light activation binds to sspB.DepositorInsertscFv-GCN4
UseLentiviralTagssuperfold GFP-GB1-NLS-iLIDExpressionMammalianPromoterSFFVAvailable SinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLQ5080_pHR_PGK_sfGFP_CoV-F2
Plasmid#155304PurposeSARS-CoV-2 fluorescent reporter 2DepositorUseLentiviralExpressionMammalianPromoterPGKAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i3-msfGFP
Plasmid#180322Purposemammalian expression of human SEPT9_i3 fused to monomeric superfolder GFPDepositorAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only