We narrowed to 16,223 results for: grn
-
Plasmid#188775PurposedCas9 with an N-term Zim3 KRAB-NLS fusion, a C-term HA-2xNLSDepositorInsertZim3-dCas9-mTagBFP2
UseLentiviralTagsHA-2xNLS-mTagBFP2 and Zim3 KRAB-NLS fusionPromoterEF1aAvailable SinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
DD-Cas9 with filler sequence and Venus (EDCPV)
Plasmid#90085PurposeThis plasmid contains destabilized Cas9 and has Venus after P2A sequence. This vector also contains filler sequence which required to be removed for cloning of desired sgRNADepositorInsertCas9
UseCRISPR and LentiviralTagsDestabilized Domain and FlagExpressionMammalianPromoterEFSAvailable SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-EF1a-Zim3-dCas9-P2A-GFP
Plasmid#188778PurposedCas9 with an N-term Zim3 KRAB-NLS fusion, a C-term HA-2xNLSDepositorInsertZim3-dCas9
UseLentiviralTagsHA-2xNLS and Zim3 KRAB-NLS fusionPromoterEF1aAvailable SinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR_zeo_sgTP53
Plasmid#183180PurposepLentiCRISPR that is selectable with zeocin with an sgRNA targeting TP53DepositorAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pH-nCas9-PPE-V2
Plasmid#170131PurposeFor plant prime editing in rice plants or monocotyledons protoplastsDepositorInsertnCas9(H840A)-M-MLV
UseCRISPRExpressionPlantMutationH840A for Cas9; D200N, T306K, W313F, T330P and L…Promotermaize Ubiquitin-1, OsU3Available SinceMay 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHSN6I01
Plasmid#50587PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-KRAB, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInsertsdCas9-KRAB
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG, HA, and NLSMutationdCas9 that is defective in DNA cleavage; the maiz…Promoter2×35Sp and AtU6-26pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pThermoCas9_ctrl
Plasmid#100981PurposeExpresses ThermoCas9 and its sgRNA moduleDepositorInsertsCas9 from the type IIc CRISPR-Cas sytem of Geobacillus thermodenitrificans T12 strain
ThermoCas9 single guide RNA expressing module
TagsNoneExpressionBacterialPromoterB. coagulans DSM 1 pta promoter and B. smithii xy…Available SinceNov. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Puro-P2A-EGFP_mRFPstuf
Plasmid#137730PurposeExpresses customizable S. Pyogenes sgRNA from U6 promoter and PuroR-P2A-EGFP from EF-1a promoter. Stuffer contains mRFP from a bacterial promoter, enabling simple visual quality control step of sgRNADepositorTypeEmpty backboneUseCRISPR, Lentiviral, Mouse Targeting, and Syntheti…ExpressionBacterial and MammalianAvailable SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
sgCTNNB1 Nicking
Plasmid#169845PurposeExpress a nicking sgRNA used for installation of the oncogenic S45F or S45del in Ctnnb1 in mouse liver.DepositorInsertsgCTNNB1 Nicking (Ctnnb1 Mouse)
ExpressionMammalianAvailable SinceJune 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-Grin2a KI
Plasmid#131486PurposeEndogenous tagging of GluN2a: N-terminal (amino acid position: A25)DepositorAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-Grin2b KI
Plasmid#131487PurposeEndogenous tagging of GluN2b: N-terminal (amino acid position: S34)DepositorAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV_NLS-SaCas9-NLS-VPR
Plasmid#68496PurposeAAV vector containing SaCas9 fused to VPRDepositorInsertSaCas9-VPR
UseAAV and CRISPRTagsVPRExpressionMammalianPromoterCMVAvailable SinceSept. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-HDR-mEGFP-camk2a
Plasmid#104589PurposeAAV vector including gRNA expression cassette and mEGFP knock-in donor targeting mouse camk2aDepositorInsertcalcium/calmodulin-dependent protein kinase II alpha (Camk2a Mouse)
UseAAV, CRISPR, and Mouse TargetingPromoterNoneAvailable SinceDec. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti-guide-puro mAtp5c-2
Plasmid#198480Purposelentiviral stable expression of mAtp5c gRNA 2DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-guide-puro mCert1-1
Plasmid#198487Purposelentiviral stable expression of mCert1 gRNA 1DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-guide-puro mPHB2-1
Plasmid#198483Purposelentiviral stable expression of mPHB2 gRNA 1DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-guide-puro mHgs-2
Plasmid#198482Purposelentiviral stable expression of mHgs gRNA 2DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-guide-puro mCct8 - 1
Plasmid#198503Purposelentiviral stable expression of mCct8 gRNA 1DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
sgGFP_3
Plasmid#78165PurposesgGFPDepositorInsertGFP
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only