We narrowed to 8,811 results for: CAG
-
Plasmid#172835PurposeMammalian expression of a sgRNA targeting the intron 1 of Tuba1b (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of Tuba1b under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_CALR sgRNA / hSpCas9
Plasmid#172838PurposeMammalian expression of a sgRNA targeting the intron 1 of CALR (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of CALR under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAB-HDAC5(mut-H-Y)
Plasmid#114398PurposeFor PYL-HDAC5 H1006Y expressionDepositorInsertPYL-HDAC5 H1006Y
UseTagsExpressionMammalianMutationadditional D593E compared to NCBI ref NP_005465.2PromoterCMVAvailable sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAB(EXPR-PYL-HDAC5-NEO)
Plasmid#114395PurposeFor PYL-HDAC5 expressionDepositorInsertPYL-HDAC5
UseTags3xFlag-NLS (internal)ExpressionMammalianMutationD593E compared with NCBI reference NP_005465.2PromoterCMVAvailable sinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAB-HDAC5(mut-H-A)
Plasmid#114397PurposeFor PYL-HDAC5 H1006A expressionDepositorInsertPYL-HDAC5 H1006A
UseTags3xFlag-NLS (internal)ExpressionMammalianMutationD593E compared to NCBI ref NP_005465.2PromoterCMVAvailable sinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAB-EXPR(PYL-cat_dom_HDAC5)
Plasmid#114401PurposeFor PYL-HDAC5 catalytic domain expressionDepositorInsertPYL-HDAC5 catalytic domain
UseTags3xFlag-NLS (internal)ExpressionMammalianMutationS220F and the deletion of M221PromoterCMVAvailable sinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAB-EXPR(PYL-Nterm_dom_HDAC5)
Plasmid#114402PurposeFor PYL-HDAC5 N terminal domain expressionDepositorInsertPYL-HDAC5 N terminal domain
UseTags3xFlag-NLS (internal)ExpressionMammalianMutationD593E compared to NCBI ref NP_005465.2PromoterCMVAvailable sinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAK_DR30_CasRx_GFP
Plasmid#134843PurposeAll in one overexpression of CasRx and guideRNADepositorInsertRfxCas13d
UseCRISPRTagsT2A EGFPExpressionMammalianMutationPromoterCAGAvailable sinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAK_DR30_CasRx_mCherry
Plasmid#134844PurposeAll in one overexpression of CasRx and guideRNADepositorInsertRfxCas13d
UseCRISPRTagsT2A mCherryExpressionMammalianMutationPromoterCAGAvailable sinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAK_DR30_CasRx_Puro
Plasmid#134845PurposeAll in one overexpression of CasRx and guideRNADepositorInsertRfxCas13d
UseCRISPRTagsT2A PuromycinExpressionMammalianMutationPromoterCAGAvailable sinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRT029
Plasmid#127969Purposedouble-DHFR-degron controlled expression of dCas9-BFP-KRAB from the CLYBL locusDepositorInsertCLYBL-CAG-DHFR-dCas9-BFP-KRAB-DHFR
UseTALENTagsExpressionMammalianMutationPromoterCAGAvailable sinceAug. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRT043-CLYBL-DDdcas9-VPH
Plasmid#158091PurposeInducible expression of dCas9-VPH from the CLYBL locus for CRISPR activationDepositorInsertCLYBL-CAG-DDdCas9VPH-T2A-GFP
UseTALENTagsExpressionMammalianMutationPromoterCAGAvailable sinceJune 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
mouse b3 full length
Plasmid#217814PurposeFull length mouse integrin b3 expressionDepositorInsertITGB3 (Itgb3 Mouse)
UseTagsP2A-mCherryExpressionMammalianMutationPromoterCAGAvailable sinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
UseTagsExpressionMammalianMutationPromoterCAG and Human U6Available sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMTL3
Plasmid#127966Purposeconstitutive expression of KRAB-dCas9-BFP-KRAB from the AAVS1 locusDepositorInsertAAVS1-CAG-KRAB-dCas9-BFP-KRAB
UseTALENTagsExpressionMammalianMutationPromoterCAGAvailable sinceNov. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMTL5
Plasmid#127967PurposeDHFR-degron controlled expression of KRAB-dCas9-BFP-KRAB from the AAVS1 locusDepositorInsertAAVS1-CAG-DHFR-KRAB-dCas9-BFP-KRAB
UseTALENTagsExpressionMammalianMutationPromoterCAGAvailable sinceNov. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
mouse av full length
Plasmid#217809PurposeFull length mouse integrin av expressionDepositorInsertITGAV (Itgav Mouse)
UseTagsP2A-EGFPExpressionMammalianMutationPromoterCAGAvailable sinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_VCL sgRNA / hSpCas9
Plasmid#172837PurposeMammalian expression of a sgRNA targeting the intron 21 (last intron) of VCL (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 21 of VCL under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
mouse a2b full length
Plasmid#217812PurposeFull length mouse integrin a2b expressionDepositorInsertITGA2B (Itga2b Mouse)
UseTagsP2A-EGFPExpressionMammalianMutationPromoterCAGAvailable sinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_TOMM20 sgRNA / hSpCas9
Plasmid#172836PurposeMammalian expression of a sgRNA targeting the intron 4 (last intron) of TOMM20 (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 4 of TOMM20 under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
mouse a5 full length
Plasmid#217810PurposeFull length mouse integrin a5 expressionDepositorInsertITGA5 (Itga5 Mouse)
UseTagsExpressionMammalianMutationPromoterCAGAvailable sinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-i4 sgRNA / hSpCas9
Plasmid#172828PurposeMammalian expression of a sgRNA targeting the intron 1 position 4 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the intron 1 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
human a5 full length
Plasmid#217818PurposeFull length human integrin a5 expressionDepositorInsertITGA5 (ITGA5 Human)
UseTagsP2A-EGFPExpressionMammalianMutationPromoterCAGAvailable sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
R26TV LSL-TRL
Plasmid#68476PurposeRosa26 targeting vector expressing Cre-dependent tTR-KRAB-rtTA3-Luc cassetteDepositorInserttTR-KRAB-2A-rtTA3-2A-Luciferase
UseCre/Lox, Luciferase, and Mouse TargetingTagsExpressionMammalianMutationPromoterCAGAvailable sinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-i1 sgRNA / hSpCas9
Plasmid#172825PurposeMammalian expression of a sgRNA targeting the intron 1 position 1 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the intron 1 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSBK.014
Plasmid#187215PurposeExpresses retron Eco1 ncRNA v35 (long a1/a2, barcode 6 [CAG-CTG]), and Cas1 + Cas2DepositorInsertsRetron Eco1 ncRNA v35 (long a1/a2, barcode 6 [CAG-CTG])
Cas1 + Cas2
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterT7/LacAvailable sinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330_rActb sgRNA / hSpCas9
Plasmid#172833PurposeMammalian expression of a sgRNA targeting the intron 1of rat Actb (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of rActb under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_rSyn1 sgRNA / hSpCas9
Plasmid#172840PurposeMammalian expression of a sgRNA targeting the intron 21 (last intron) of rSyn1 (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 21 of rSyn1 under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
mouse b6 full length
Plasmid#217816PurposeFull length mouse integrin b6 expressionDepositorInsertITGB6 (Itgb6 Mouse)
UseTagsP2A-mCherryExpressionMammalianMutationPromoterCAGAvailable sinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
mouse b8 full length
Plasmid#217817PurposeFull length mouse integrin b8 expressionDepositorInsertITGB8 (Itgb8 Mouse)
UseTagsP2A-mCherryExpressionMammalianMutationPromoterCAGAvailable sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSBK.011
Plasmid#187211PurposeExpresses retron Eco1 ncRNA v35 (long a1/a2, barcode 3 [CTG-CAG]), and Cas1 + Cas2DepositorInsertsRetron Eco1 ncRNA v35 (long a1/a2, barcode 3 [CTG-CAG])
Cas1 + Cas2
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterT7/LacAvailable sinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-e1 sgRNA / hSpCas9
Plasmid#172830PurposeMammalian expression of a sgRNA targeting the exon 2 position 1 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the exon 2 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-e2 sgRNA / hSpCas9
Plasmid#172831PurposeMammalian expression of a sgRNA targeting the exon 2 position 2 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the exon 2 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_Camk2a sgRNA / hSpCas9
Plasmid#172839PurposeMammalian expression of a sgRNA targeting the intron 17 (last intron) of Camk2a (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 17 of Camk2a under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-i5 sgRNA / hSpCas9
Plasmid#172829PurposeMammalian expression of a sgRNA targeting the intron 1 position 5 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the intron 1 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-i3 sgRNA / hSpCas9
Plasmid#172827PurposeMammalian expression of a sgRNA targeting the intron 1 position 3 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the intron 1 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-i2 sgRNA / hSpCas9
Plasmid#172826PurposeMammalian expression of a sgRNA targeting the intron 1 position 2 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the intron 1 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCSIIbleo-iRFP670-P2A-EGFP
Plasmid#198060PurposeThe lentiviral vector for iRFP670 and EGFPDepositorInsertiRFP670
UseLentiviralTagsP2A-EGFPExpressionMammalianMutationPromoterCAGAvailable sinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCSIIbleo-miRFP670nano-P2A-EGFP
Plasmid#198064PurposeThe lentiviral vector for miRFP670nano and EGFPDepositorInsertmiRFP670nano
UseLentiviralTagsP2A-EGFPExpressionMammalianMutationPromoterCAGAvailable sinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
Borealin-mTAG-RFPt-3XFLAG
Plasmid#191986PurposeMammalian expression of PTK BorealinDepositorInsertBorealin
UseTagsExpressionMammalianMutationPromoterCAGAvailable sinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pC13N-dCas9-BFP-KRAB
Plasmid#127968Purposeconstitutive expression of dCas9-BFP-KRAB from the CLYBL locus (Ward lab)DepositorInsertCLYBL-CAG-dCas9-NLS-BFP-KRAB
UseTALENTagsExpressionMammalianMutationPromoterCAGAvailable sinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
UPB-esophagus (UPB5)
Plasmid#180783PurposeUnique Projection Barcode (UPB5)-Esophagus for Projection-seqDepositorInserthM3Dq ( partial ) (CHRM3 Human)
UseAAVTagsExpressionMammalianMutationPromoterCAGAvailable sinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENN239_CRISPRcharm_Kv1
Plasmid#220838PurposeCRISPRcharm Kv1 expression in mammalian cellsDepositorInsertCRISPRcharm Kv1
UseCRISPRTagsP2A-TagBFPExpressionMammalianMutationN/APromoterCAGAvailable sinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENN236_CRISPRcharm_Kv2
Plasmid#220839PurposeCRISPRcharm Kv2 expression in mammalian cellsDepositorInsertCRISPRcharm Kv2
UseCRISPRTagsP2A-TagBFPExpressionMammalianMutationN/APromoterCAGAvailable sinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET32a-HD46Q
Plasmid#11515DepositorInserthuntingtin, exon 1, 46Q glutamines (HTT Human)
UseTagsHis, His (out of frame), and TrxExpressionBacterialMutationhuntingtin exon 1 with 46 glutamines, vector m…PromoterAvailable sinceApril 28, 2006AvailabilityAcademic Institutions and Nonprofits only -
pENN226_CRISPRcharm
Plasmid#220834PurposeCRISPRcharm expression in mammalian cellsDepositorInsertCRISPRcharm
UseCRISPRTagsP2A-TagBFPExpressionMammalianMutationN/APromoterCAGAvailable sinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET32a-HD25Q
Plasmid#11508DepositorInserthuntingtin, exon 1, 25 glutamines (HTT Human)
UseTagsHis, His (out of frame), and TrxExpressionBacterialMutationhuntingtin exon 1 with 25 glutamines, vector m…PromoterAvailable sinceApril 28, 2006AvailabilityAcademic Institutions and Nonprofits only -
pSLQ10844
Plasmid#183956PurposeCAG-hyperdCas12a-HA-miniVPR-mCherry-T2A-HygroRDepositorInsertHyperdCas12a
UseCRISPRTagsHA, Hygromycin Resistance, and mCherryExpressionMammalianMutationD832A, D156R, E292R, D235R, D350RPromoterCAGAvailable sinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
enIscB-T5E
Plasmid#205411PurposeVector encoding human codon-optimized enhanced-activity OgeuIscB fused with T5E at C-terminal driven by CAG promoter, optimized _RNA (_RNA*) driven by hU6, and mCherry driven by CMV promoterDepositorInsertpCAG_Flag_SV40NLS_OgeuIscB*_XTEN_T5E_npNLS_pU6__RNA*_pCMV_mCherry
UseTagsExpressionMammalianMutationE85R+H369R+S387R+S457RPromoterCAG, hU6, CMVAvailable sinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJC49
Plasmid#133060PurposeLentiviral vector with a (Ubiquitous Chromatin Opening Element) UCOE upstream of a CAG promoter constitutively expressing a single insert containing the Tau.K18(P301L/V337M)-mScarlet-I fusion protein.DepositorInsertTau.K18(LM)
UseLentiviralTagsmScarletIExpressionMammalianMutationPromoterCAGAvailable sinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only