We narrowed to 4,446 results for: GCA
-
Plasmid#90529Purpose3rd generation lentiviral gRNA plasmid targeting human ANAPC1DepositorInsertANAPC1 (Guide Designation A2.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV.CBA.YFP.miR-E_shStk16-1
Plasmid#180391PurposeProducing AAV that encodes mouse Stk16 shRNA-1 with miR-E backboneDepositorAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJG488
Plasmid#91196PurposeWDV replicon T-DNA for gene targeting in wheat scutella, H840A double nickase (nTaCas9_H840A+gUbi8+gUbi1+donor)DepositorInsertnTaCas9_H840A+gUbi8+gUbi1+donor
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pQCascade-IS2
Plasmid#140625PurposeExpresses V. cholerae TniQ, Cas8, Cas7, and Cas6 and crRNA-IS2. The crRNA-IS2 targets IS2 loci in Escherchia coli.DepositorInsertVchTniQ, VchCas8, VchCas7, VchCas6, crRNA-IS2
UseCRISPR; TransposonExpressionBacterialAvailable SinceJuly 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAT15416-BEAR-mScarlet-target-BFP
Plasmid#162996Purposeplasmid expressing an sgRNA targeting the BEAR-mScarlet plasmid along with a TagBFP markerDepositorInsertsgRNA targeting the BEAR-mScarlet plasmid
UseCRISPRExpressionMammalianPromoterU6Available SinceSept. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLG1-puro-sgATL3-2
Plasmid#109010PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pB-puro-mU6-CNPshRNA1
Plasmid#126611PurposeExpresses shRNA against human CNP under mouse U6 promoterDepositorAvailable SinceJune 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G3_RUNX1_Nick-38_Dual_sgRNA
Plasmid#173214PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G3 and RUNX1 nick-38 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G3 sgRNA + RUNX1 Nick-38 sgRNA
UseCRISPR; Prime editing (pe3)ExpressionMammalianPromoterTandem U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR sgHAL
Plasmid#102315Purposegenetic depletion of HALDepositorAvailable SinceJuly 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
WPXL LEFTY2 gRNA
Plasmid#101924PurposeLEFTY2 gRNA used for targeted demethylation is inserted into the WPXL lentiviral backbone.DepositorInsertLEFTY2 enhancer targeting gRNA
UseLentiviralAvailable SinceDec. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRSET a sfMatryoshCaMP6s
Plasmid#100020PurposeBacterial expression of fluorescent reporter for calcium signaling, based off of GCaMP6s. Contains a stable reference Large Stokes Shift (LSS) mOrange nested within the reporting superfolder cpGFP.DepositorInsertsfMatryoshCaMP6s
Tags6x HIS tag and Xpress_EK tagExpressionBacterialMutationcpEGFP replaced with superfolder cpGFPPromoterT7Available SinceOct. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
PPP2R5D B12.5 gRNA
Plasmid#90854Purpose3rd generation lentiviral gRNA plasmid targeting human PPP2R5DDepositorInsertPPP2R5D (Guide Designation B12.5)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAS19
Plasmid#158788PurposeRibosome-tagged GCaMP (soma localized) expression in C. elegans ASH neuronsDepositorInsertpsra-6::GCaMP6m::rpl-1a
ExpressionWormAvailable SinceSept. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAS16
Plasmid#158786PurposeRibosome-tagged GCaMP (soma localized) expression in C. elegans AFD neurons (and others)DepositorInsertPntc-1::GCaMP6m::rpl-1a
ExpressionWormAvailable SinceSept. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
BUB3 A10.1 gRNA
Plasmid#90557Purpose3rd generation lentiviral gRNA plasmid targeting human BUB3DepositorInsertBUB3 (Guide Designation A10.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 hygro shRNA human Fis1
Plasmid#252272PurposeKnockdown of human Fis1DepositorAvailable SinceFeb. 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
PB_rtTA_BsmB-HNRNPU_sgRNA_1
Plasmid#242901PurposePiggyBac cargo vector with HNRNPU sgRNA 1 for dox-inducible knockdownDepositorAvailable SinceFeb. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTol1-U6abc_tnnt2a_cmlc2-nmKate
Plasmid#238309PurposeDrives expression of 3 different gRNAs targeting tnnt2a, and expression of nuclear mKate in cardiomyocytes.DepositorInsertnuclear mKate/3 gRNAs targeting tnnt2a
Promotercmlc2 (nmKate); U6 (gRNAs)Available SinceNov. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only