We narrowed to 6,964 results for: GFP expression plasmids
-
Plasmid#79373PurposeRecruits VPR to a compatible Cas9 protein for transcriptional activationDepositorInsertGCN4-sfGFP-VPR
UseCRISPRExpressionMammalianAvailable SinceOct. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(2)
Plasmid#136059PurposeG3BP1 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTATTACACACTGCTGAACC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(1)
Plasmid#136058PurposeG3BP1 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTAGTCCCCTGCTGGTCGGGC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(1)
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
GFAP-Archon-EGFP
Plasmid#187979PurposeExpresses the fluorescent voltage indicator Archon under the GFAP promoterDepositorInsertArchon1-EGFP
UseAAVAvailable SinceAug. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGFP-PTEN C124A
Plasmid#50520PurposeThis plasmid contains GFP21, which has a sequence similar to YFP, but emission/excitation similar to GFP.DepositorAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
LLP726_L2_pV01_0I_TMV-tGFP_TCTP-fLUC
Plasmid#192406PurposeTo be a control plasmid that has no Rluc repression (replaced by turboGFP) and should reflect true off state of the circuit.DepositorInsertAct2::Turbo GFP
UseSynthetic BiologyTagsN7ExpressionPlantAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(2)
Plasmid#136061PurposeG3BP2 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GACAACTACTCCATCACTCA)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGFP-PTEN D92A
Plasmid#50521PurposeThis plasmid contains GFP21, which has a sequence similar to YFP, but emission/excitation similar to GFP.DepositorAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pACUH 5-HT2BR-7xGFP11-HA
Plasmid#221840PurposePlasmid for generating 10xUAS-5-HT2BR-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.luxR(mut)-sggfp(A)
Plasmid#236039PurposeThe plasmid pQdCas12a.luxR(mut)-sggfp(A) expresses the dCas12a endonuclease and the sgRNA (design A) targeting the gfp gene. Additionally, it contains a mutation in the luxR gene.DepositorInsertquorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (B) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLei-sfGFP-D134*
Plasmid#191110PurposeAn E. coli sfGFP reporter with one TAG at position 134DepositorInsertsuperfolder green fluorescence protein
TagsHis tagExpressionBacterialMutationchanging D134 to TAGAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLei-sfGFP-V2*D134*
Plasmid#191111PurposeAn E. coli sfGFP reporter with two TAG at positions 2 & 134DepositorInsertsuperfolder green fluorescence protein
TagsHis tagExpressionBacterialMutationchanging V2 & D134 to TAGAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUt-MONARCH 1.0_crEGFP
Plasmid#224790PurposeLPUtopia matching RMCE donor plasmid with MONARCH 1.0 circuit with crRNA targeting EGFP. Use BlastR for positive and HSV-TK for negative selectionDepositorInsertcrEGFP
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterCMV-d2iAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Puro cTnT CCND2-T2A-ChloC-P2A-eGFP
Plasmid#179840Purposedonor plasmid for cardiac-specific CCND2-T2A-Chloc-P2A-eGFP expression in human cellsDepositorInsertCCND2 (CCND2 Human)
UseCRISPR and TALEN; Donor plasmidTagschloride-conducting ChR (ChloC) and eGFPExpressionMammalianPromoterTroponin T promoterAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pALS2-sfGFP WT
Plasmid#197575PurposeFluorescence control plasmid for selecting ncAA-encoding Methanomethylophilus alvus Pyl-RS mutants. Expresses sfGFP-WT and M. alvus Pyl-tRNA(6). p15a origin of replicationDepositorInsertssfGFP WT
M. alvus Pyl-tRNA (6)
TagsHis6ExpressionBacterialPromoteraraC and lppAvailable SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
ST-2xTstem(5A)-GFP
Plasmid#162504PurposeExpresses a ST6GAL1 mutant with a GFP tag in its C-terminus in mammalian cells. One wildtype Tac stem region is inserted within ST and the other mutated Tac stem region is inserted between ST and GFP.DepositorTagsGFPExpressionMammalianMutationOne Tac stem region is inserted within ST6Gal1 an…Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
ST-2xTstem-GFP
Plasmid#162503PurposeExpresses a ST6GAL1 mutant with a GFP tag in its C-terminus in mammalian cells. One Tac stem region is inserted within ST and the other Tac stem region is inserted between ST and GFP.DepositorTagsGFPExpressionMammalianMutationOne Tac stem region is inserted within ST6Gal1 an…Available SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
eGFP-PRM-3R
Plasmid#112156PurposeMammalian eGFP expression plasmid for PRM-3R.DepositorInsertPRM-3R (ABL1 Human)
ExpressionMammalianMutationcontains only the PRM domain of ABl1PromoterCMVAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DO_DIO-TdTomato_EGFP-WPRE-pA
Plasmid#37120PurposeDO/DIO Cre-Switch. Expresses tdTomato in Cre negative cells, expresses EGFP in Cre positive cellsDepositorInsertTdTomato-EGFP
UseAAV and Cre/Lox; Cre-switchPromoterEF1aAvailable SinceJuly 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMVSP6-nEGFP-SV40-PURO
Plasmid#138364PurposeLentiviral plasmid for nuclear EGFP expression driven by CMVSP6 and puromycin resistance under SV40 promoter for selectionDepositorInsertnuclear EGFP
UseLentiviralExpressionMammalianAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-FLPo-T2A-GFP
Plasmid#161766Purposeexpress FLPo and GFP under the control of human synapsin promoterDepositorInsertsFLPo
T2AEGFP
UseAAVExpressionMammalianPromoterhSynapsin1Available SinceNov. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSMART-HCKan-yibDp-VHH-GFPenhancer
Plasmid#202468PurposeExpresses the nanobody GFP enhancer after phosphate depletionDepositorInsertnanobody GFP enhancer
Tags6X-HisExpressionBacterialPromoteryibDpAvailable SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSMART-HCKan-yibDp-VHH-GFPminimizer
Plasmid#202469PurposeExpresses the nanobody GFP minimizer after phosphate depletionDepositorInsertnanobody GFP minimizer
Tags6X-HisExpressionBacterialPromoteryibDpAvailable SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-GFP1 POD-nAb-WPRE
Plasmid#244973PurposeExpresses a fusion protein of a nanobody against GFP and peroxidase (POD) in mammalian cellsDepositorInsertGFP1 POD-nAb
Available SinceOct. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-DTR-GFP
Plasmid#124364Purposeconditional expression of a diphtheria toxin receptor (DTR)–GFP fusion proteinDepositorHas ServiceAAV2InsertDTR-GFP
UseAAVTagsGFPPromoterChicken B-actinAvailable SinceOct. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-EFS-PCP-GFPnls
Plasmid#121938PurposeCRISPR-Sirius plasmidDepositorInsertPCP-GFPnls
UseLentiviralTagssfGFPExpressionMammalianPromoterEFSAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pACAGW-H2B-PAGFP-AAV
Plasmid#33000DepositorInsertH2B-PAGFP (H2BC21 Aequorea victoria, Human)
UseAAV; Adeno associated virusTagsPAGFPExpressionMammalianAvailable SinceDec. 12, 2011AvailabilityAcademic Institutions and Nonprofits only -
scFv-GCN4-sfGFP-deadTET1CD
Plasmid#184442PurposeCatalytically DEAD TET1CD with scFv against GCN4DepositorInsertCatalytically DEAD TET1
UseCRISPR and LentiviralExpressionMammalianAvailable SinceSept. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLoxP-EGFP-crRNA-entry
Plasmid#213048PurposeSWITCHER ready LoxP-EGFP reporter plasmid for cloning of a customized CRISPR-inducible Cre-constructDepositorInsertLoxP-EGFP-MALAT1-triplex
UseCRISPRExpressionMammalianAvailable SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-22b(+) pCopA sfgfp
Plasmid#226374PurposePlasmid carries copper sensor circuit genes for whole-cell sensing of copper ions with native RBS (ribosome binding site).DepositorInsertsfGFP
Tags6x HisTagExpressionBacterialPromoterpCopAAvailable SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
Zhou-pLOV-GFP-Luc
Plasmid#161030PurposeLentiviral vector expressing GFP and luciferase for use as a reporter in pseudovirus production and infection.DepositorInsertGFP and luciferase
UseLentiviralAvailable SinceJuly 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuperCRISPR-sgRNA-EGFP12-WT(TTTT)
Plasmid#215856PurposeThis plasmid encodes sgRNA that target EGFP with stretch sequenceDepositorInsertsgRNA-EGFP12 with TTTT stretch
UseRetroviralExpressionMammalianAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-EGFP-NLS-3XFLAG-V5
Plasmid#196090PurposeExpresses gfp in mammalian cells. Contains a c-terminal 3xFlag tag and a c-terminal V5 tagDepositorInsertGFP
TagsC-terminal 3xFLAG and C-terminal V5ExpressionBacterial and MammalianPromoterCAGGsAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pB6-Hipp11-H2B-sfGFP-T2A-tdTomato-cre reporter-3pA stop-FNF-DTA
Plasmid#183027PurposeB6J Hipp11-FNF-pCAG-loxP-3xSV40pA-loxP-H2B-sfGFP-T2A-tdTomato-WPRE-bpA allele targeting vector, low copy numberDepositorInsertH2B-sfGFP-T2A-tdTomato
UseCre/Lox and Mouse TargetingExpressionBacterial and MammalianAvailable SinceApril 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
p226-AAV-dlx-dio-mScarlet-T2A-SYPEGFP
Plasmid#185696PurposeAAV vector expressing cre-dependent mem-mScarlet, T2A, Synaptophysin-EGFP driven by Dlx promoterDepositorInsertmScarlet, T2A, Synaptophysin-EGFP
UseAAV and Cre/LoxTagsmScarlet palmitoylation, Synaptophysin fused to E…ExpressionMammalianPromotermDlxAvailable SinceJuly 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
LITE1.0_pAAV_hSyn_TALE(Grm2)-NLS-CIB1_2A_GFP_WPRE_bGHpA
Plasmid#47453PurposeepiLITE / LITE1.0 TALE-CIB1. CIB1 binds to blue-light-activated CRY2PHR. Particular TALE targeted to Grm2 promoter. Synapsin promoter for neuronal expression.DepositorInsertTALE (N136,Grm2,C63)-cib1
UseAAV; TaleTagsHAExpressionMammalianPromoterhSyn human synapsin (mammalian neuronal expressio…Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EF1a-hMLH1dn-eGFP
Plasmid#191104PurposeLentiviral expression plasmid of hMLH1dn with P2A-eGFP reporterDepositorInserthMLH1dn
UseLentiviralExpressionMammalianPromoterEF-1aAvailable SinceMay 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPRIME-TET-GFP-FF3
Plasmid#11662Purpose3rd generation lentiviral transfer vector. pPRIME cloning plasmid with a tetracycline-responsive promoter (TET) controlling expression of GFP and miR30-based shRNA targeting firefly luciferaseDepositorInsertFF3
UseLentiviralTagsGFPExpressionMammalianAvailable SinceMarch 1, 2007AvailabilityAcademic Institutions and Nonprofits only -
bdSUMO-ZF5.3-GFP-HiBit
Plasmid#170992PurposeFor bacterial expression of bdSUMO tagged muGFP with ZF5.3 peptide and NanoLuc complementation peptide variant #86DepositorInsert14x-His-bdSUMO-muGFP-HiBiT
UseLuciferaseExpressionBacterialPromoterT7Available SinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only