We narrowed to 2,739 results for: SAB
-
Plasmid#185620PurposeRibosomal stalling reporter: 15x isoleucineDepositorInsertGFP-I15-mCherry
ExpressionMammalianPromoterCMVAvailable SinceNov. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-FAS-NES-jRGECO1a-WPRE
Plasmid#141236PurposeAAV vector with Ef1a promoter and LoxFAS sites for Cre-Off expression of jRGECO1a (jRGECO1a will not be expressed in mammalian cells that express Cre recombinase)DepositorInsertNES-jRGECO1a
UseAAV and Cre/Lox; Cre-offTags6xHIS tag and nuclear export signalPromoterhuman elongation factor-1 alpha (EF-1 alpha)Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuper DGK alfa human
Plasmid#224574PurposeTo downregulate the expression of human DGK alfa in human cellsDepositorAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuper DGK alfa mouse
Plasmid#224573PurposeNegative Control for expression downregulation of DGK alfa human in human cellsDepositorAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28 mePOU-POU
Plasmid#206392PurposeExpresses the DNA binding domain of the ePOU with a 6xHis tag for protein purificationDepositorInsertePOU
Tags6xHisExpressionBacterialMutationPOU DNA binding domain onlyAvailable SinceOct. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSHDY*in_PpetE:BCD2:AgBIS:Flag
Plasmid#133971PurposeHeterologous, copper-inducible expression of (E)-α-bisabolene synthase from Abies grandis (AgBIS) in Synechocystis sp. PCC 6803. The AgBIS CDS is fused to a C-termial Flag-tag.DepositorInsertAgBIS:Flag
UseSynthetic BiologyTagsFlagExpressionBacterialMutationinserted gene is codon optimized for Synechocyst…PromoterPpetE:BCD2Available SinceApril 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSHDY*in_PpetE:BCD2:MrBBS:Strep
Plasmid#133973PurposeHeterologous, copper-inducible expression of (-)-α- bisabolol synthase from Matricaria recutita (MrBBS) in Synechocystis sp. PCC 6803. The MrBBS CDS is fused to a C-termial StrepII-tag.DepositorInsertMrBBS:StrepII
UseSynthetic BiologyTagsStrepIIExpressionBacterialMutationinserted gene is codon optimized for Synechocyst…PromoterPpetE:BCD2Available SinceApril 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
NDUFAB1 C3.3 gRNA
Plasmid#90791Purpose3rd generation lentiviral gRNA plasmid targeting human NDUFAB1DepositorAvailable SinceAug. 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
NDUFAB1 C4.3 gRNA
Plasmid#90793Purpose3rd generation lentiviral gRNA plasmid targeting human NDUFAB1DepositorAvailable SinceJuly 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
fluoPEER-GFP>BFP
Plasmid#185477PurposeFluorescent reporter for a Y66H mutation to convert a GFP to BFP.DepositorInsertGFP-Y66-editing-site
ExpressionMammalianPromoterCMVAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr-mKO-MK2
Plasmid#115492PurposeExpression vector for the p38 activity reporter mKO-MK2 in mammalian cellsDepositorInsertmKO-MK2 (MAPKAPK2 Human)
Tagsmonomeric Kusabira Orange (mKO)ExpressionMammalianPromoterCAGAvailable SinceDec. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-FH-AGO2-WT
Plasmid#91978PurposeExpresses FLAG-HA-AGO2 (WT)DepositorAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pegRNA-HEK3_del1-5-NGG
Plasmid#185478PurposepegRNA plasmid in order to make a 5 basepair deletion at the HEK3 locus, uses an NGG-PAM site.DepositorInsertHEK3_del1-5-NGG pegRNA
ExpressionMammalianPromoterU6Available SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
Tol2-elavl3-H2B-GCaMP6s
Plasmid#59530PurposeExpressed nuclear-localized GCaMP6-slow, a calcium indicator, in neurons in zebrafish larva. The plasmid is in Tol2 transposon backboneDepositorInsertsUseTransposable elementAvailable SinceSept. 12, 2014AvailabilityAcademic Institutions and Nonprofits only -
pmCherry C1 Omp25
Plasmid#157758PurposeExpression of mcherry-labelled mitochondrial outer membrane protein 25 in cellsDepositorAvailable SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
fluoPEER-HEK3_5bp-del
Plasmid#185476PurposeFluorescent reporter for a 5 basepair deletion at the HEK3 locus.DepositorInsertHEK3 editing site
ExpressionMammalianPromoterCMVAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET21a-C2m2-SNAP
Plasmid#208773PurposeTo express C2m2-SNAP in bacteriaDepositorInsertC2m2-SNAP (Mfge8 Mouse)
TagsSNAP-tagExpressionBacterialMutationMutated 24 and 45 lysine to asparagine in C2 doma…PromoterT7 promoterAvailable SinceOct. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEZYeGFP-SARS-CoV-2E
Plasmid#224580PurposeTo express a GFP tagged version of the Envelope protein of SARS-CoV-2 in mammalian cellsDepositorAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shLuc.mKO2
Plasmid#85224PurposeshLuc (Target TTACGCTGAGTACTTCGA) for silencing luciferase gene as a control and express monomeric Kusabira-Orange2.DepositorInsertFirefly Luciferase
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET21a-C2m2-mKate
Plasmid#208765PurposeTo express C2m2-mKate in bacteriaDepositorInsertC2m2-mKate (Mfge8 Mouse)
TagsmKateExpressionBacterialMutationMutated 24 and 45 lysine to asparagine in C2 doma…PromoterT7 promoterAvailable SinceOct. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-FH-AGO2-R438E
Plasmid#91984PurposeExpresses FLAG-HA-AGO2 (R438E)DepositorAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-FH-AGO2-K525E
Plasmid#91985PurposeExpresses FLAG-HA-AGO2 (K525E)DepositorAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-FH-AGO2-D358K
Plasmid#91983PurposeExpresses FLAG-HA-AGO2 (D358K)DepositorAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.1.mKO2
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-FH-AGO2-S828A
Plasmid#91982PurposeExpresses FLAG-HA-AGO2 (S828A)DepositorAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSuper DGK zeta human
Plasmid#224575PurposeTo downregulate the expression of human DGK zeta in human cellsDepositorAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuper Retro GFP DGK alfa mouse
Plasmid#224576PurposeNegative Control for downregulation of the expression of human DGK alfa in human cellsDepositorAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuper Retro GFP DGK zeta human
Plasmid#224579PurposeTo stably downregulate the expression of human DGK zeta in human cellsDepositorAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.2.mKO2
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJet-CMV-IARS1-GFP
Plasmid#212322PurposeEGFP-tagged IARS1DepositorAvailable SinceNov. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pORTMAGE311B
Plasmid#120418PurposeExpresses Lambda Beta and a dominant negative MutL E32K allele, controlled by XylS-Pm expression system for high precision and efficient MAGE experiments at 37°C. RSF1010 Ori; Broad host-range; KanRDepositorArticleInsertsMutL E32K
Lambda Beta
XylS
ExpressionBacterialMutationE32K mutation conferring dominant mutator phenoty…PromoterPmAvailable SinceFeb. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
EK0397 3FLAG-ADAR1-p150-HIS (pEAQ)
Plasmid#191172PurposeHuman ADAR1, p150 isoform in plant-expressable format.DepositorAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-C2m2-mKate
Plasmid#208793PurposeFor AAV production to express C2m2-mKate in astrocytesDepositorInsertC2m2-mKate (Mfge8 Mouse)
UseAAVTagsmKateExpressionMammalianMutationMutated 24 and 45 lysine to asparagine in C2 doma…PromoterGFAP promoterAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pegRNA-GFP>BFP_Y66H-NGG
Plasmid#185480PurposepegRNA plasmid in order to make a Y66H (TAC>CAT) conversion in the GFP gene, creating a BFP gene.DepositorInsertGFP>BFP_Y66H-pegRNA
ExpressionMammalianPromoterU6Available SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-C2m2-SNAP
Plasmid#208791PurposeFor AAV production to express C2m2-SNAP in astrocytesDepositorInsertC2m2-SNAP (Mfge8 Mouse)
UseAAVTagsSNAP-tagExpressionMammalianMutationMutated 24 and 45 lysine to asparagine in C2 doma…PromoterGFAP promoterAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEZYeGFP-SARS-CoV-2E GGG
Plasmid#224582PurposeTo express a GFP tagged version of the Envelope protein of SARS-CoV-2 with a mutated PBM in mammalian cellsDepositorInsertSARS-CoV-2E GGG (E SARS-CoV-2)
TagsGFPExpressionMammalianMutationPBM (LLV) mutated to GGGPromoterCMVAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEMS1430
Plasmid#29225PurposeExpression of the eGFP reporter gene was not detected in the brain and eye.DepositorAvailable SinceJan. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEMS1641
Plasmid#29283PurposePleiades (Ple) MiniPromoter expression pattern described in de Leeuw et al., MTM, 2014 (PMID: 24761428).DepositorInsertPle170 (POGZ Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceNov. 3, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEZYeGFP-SARS-CoV-2E stop
Plasmid#224581PurposeTo express a GFP tagged version of the Envelope protein of SARS-CoV-2 lacking its PBM in mammalian cellsDepositorInsertSARS-CoV-2E stop (E SARS-CoV-2)
TagsGFPExpressionMammalianMutationstop codon before PBMPromoterCMVAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only