We narrowed to 22,079 results for: his
-
Plasmid#85468PurposeExpression of photoactivated cyclase bPAC of Beggiatoa sp.DepositorInsertBacterial Photoactivated Adenylyl Cyclase
UseTagsHis and MycExpressionMutationPromoterT7 promoterAvailable sinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
his3MX6-ins3
Plasmid#195040PurposepFA6a derived selection cassette flanked with transcription terminators (tDEG1/tCYC1), allows genome modification without disruption of insertion neighboring genes by transcription interferenceDepositorInsertHis5+
UseYeast genomic targetingTagsS. cerevisiae DEG1 terminator, A. gossypii TEF pr…ExpressionMutationPromoterAvailable sinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
TF-bio-His
Plasmid#52184PurposeExpresses full-length Serotransferrin precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertTF (TF Human)
UseTagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
Sema4a-Fc-His
Plasmid#72154PurposeExpresses the extracellular region of the Sema4A protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertSema4a (Sema4a Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHis8-4b-SaDAH
Plasmid#140128PurposeExpresses SaDAH with N-terminal 8xHis-tag in BL21 E. coliDepositorInsertDechloroacutumine halogenase from Sinomenium acutum
UseTags8x-His, TEV protease site (ENLYFQ)ExpressionBacterialMutationPromoterT7Available sinceApril 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
Sema5a-Fc-His
Plasmid#72161PurposeExpresses the extracellular region of the Sema5A protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertSema5a (Sema5a Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
Jam1-Fc-His
Plasmid#72078PurposeExpresses the extracellular region of the JAM-1 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertJam1 (F11r Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pICE HIS3
Plasmid#122877PurposeHIS3 ICE plasmid used to facilitate yeast recombination cloning and stable genomic Integration after CEN Excision.DepositorTypeEmpty backboneUseYeast recombination cloningTagsExpressionYeastMutationPromoterAvailable sinceFeb. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
Flrt1-Fc-His
Plasmid#72073PurposeExpresses the extracellular region of the FLRT1 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertFlrt1 (Flrt1 Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema6d.1-AP-His
Plasmid#72042PurposeExpresses the extracellular region of the Sema6D, isoform 1 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertSema6d.1 (Sema6d Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
HisMBP CFlm25
Plasmid#78458PurposeInducible expression in E. coliDepositorInsertHuman Cleavage Factor lm 25 kDa subunit (NUDT21 Human)
UseTagsHis and MBPExpressionBacterialMutationPromotertacAvailable sinceJuly 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
Cntn1-AP-His
Plasmid#71939PurposeExpresses the extracellular region of the Contactin 1 protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertCntn1 (Cntn1 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema6d.1-Fc-His
Plasmid#72168PurposeExpresses the extracellular region of the Sema6D, isoform 1 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertSema6d.1 (Sema6d Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema4d-Fc-His
Plasmid#72157PurposeExpresses the extracellular region of the Sema4D protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertSema4d (Sema4d Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-his3MX6
Plasmid#33139Purposegene deletion in S. pombeDepositorInserthis3MX6
UseTagsExpressionMutationPromoterAvailable sinceJan. 19, 2012AvailabilityAcademic Institutions and Nonprofits only -
pST50Trc1-DHFRHIS
Plasmid#63949PurposePosition 1 transfer plasmid for pST44 polycistronic plasmid suite; C-term single tag; contains DHFR gene in BamHI-NgoMIV cassette as positive controlDepositorTypeEmpty backboneUseTags6xHisExpressionBacterialMutationPromoterT7Available sinceOct. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
Unc5c.a-Fc-His
Plasmid#72180PurposeExpresses the extracellular region of the Unc5C, isoform a protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertUnc5c.a (Unc5c Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceJan. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
Jam1-AP-His
Plasmid#71952PurposeExpresses the extracellular region of the JAM-1 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertJam1 (F11r Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema3f(L,+)-AP-His
Plasmid#72021PurposeExpresses the Sema3F protein (truncated at cleavage site P3; ie, long and contains no deletion in exon 3), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertSema3f (Sema3f Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMC060-HisMS2_PLP_Env_pac
Plasmid#155040PurposeGeneration of MS2 Virus Like Particles packaged with the sequence for the SARS-CoV-2 Envelope GeneDepositorInsertsMaturation Protein
Coat Protein Dimer
Envelope Gene
UseTagsExpressionBacterialMutationRemove TypeIIs Restriction SitesPromoterT7Available sinceSept. 9, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
Flrt3-AP-His
Plasmid#71949PurposeExpresses the extracellular region of the FLRT3 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertFlrt3 (Flrt3 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ncam1_1.18.1-AP-His
Plasmid#71962PurposeExpresses the extracellular region of the NCAM1, isoform 1.18.1 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertNcam1_1.18.1 (Ncam1 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ncam1_0.0.0-AP-His
Plasmid#71960PurposeExpresses the extracellular region of the NCAM1, isoform 0.0.0 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertNcam1_0.0.0 (Ncam1 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
His10-tag
Plasmid#55179Purpose10xHis-tagDepositorInsertHis10
UseSynthetic Biology; Bacillus biobrick boxTagsExpressionMutationPromoterAvailable sinceJuly 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
Cntn2-AP-His
Plasmid#71940PurposeExpresses the extracellular region of the Contactin 2 protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertCntn2 (Cntn2 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHis-hPim1
Plasmid#100722PurposeExpression of human Pim1 kinase domain in E.coliDepositorInsertPim1 (PIM1 Human)
UseTagsHisExpressionBacterialMutationResidues 29-313 of isoform 2PromoterT7 promotorAvailable sinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1MycHis/HIP1/ΔE
Plasmid#31252DepositorInsertHuntingtin-interacting protein 1 (HIP1 Human)
UseTagshis and mycExpressionBacterialMutationdeleted ENTH domainPromoterAvailable sinceSept. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
pST50Trc4-STRHISNDHFR
Plasmid#64000PurposePosition 4 transfer plasmid for pST44 polycistronic plasmid suite; N-term cleavable double tag; contains DHFR gene in BamHI-NgoMIV cassette as positive controlDepositorTypeEmpty backboneUseTags6xHis & Strep II (STR); TEV cleavableExpressionBacterialMutationPromoterT7Available sinceNov. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
T7-PseB-His6
Plasmid#89723PurposeExpresses PseB from C. jejuni with an N-terminal T7 tag and a C-terminal His6 tagDepositorInsertPseB
UseTagsHis6ExpressionBacterialMutationPromoterAvailable sinceFeb. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHisAlix deltaPRD
Plasmid#42577DepositorInsertdelta-PRD ALIX (residues 1-702) (PDCD6IP Human)
UseTagsHIS-TEVExpressionBacterialMutationsilent mutation A1617G (numbering in ALIX gene)PromoterAvailable sinceDec. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
Sema4f.b-Fc-His
Plasmid#72159PurposeExpresses the extracellular region of the Sema4F, isoform b protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertSema4f.b (Sema4f Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema7a-AP-His
Plasmid#72049PurposeExpresses the extracellular region of the Sema7A protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertSema7a (Sema7a Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pME18S-HismSin3A
Plasmid#30454DepositorInsertSin3A (Sin3a Mouse)
UseTagsHisExpressionMammalianMutationPromoterAvailable sinceJune 6, 2011AvailabilityAcademic Institutions and Nonprofits only -
Cntn3-AP-His
Plasmid#71941PurposeExpresses the extracellular region of the Contactin 3 protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertCntn3 (Cntn3 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
Sema3d(L)-AP-His
Plasmid#72017PurposeExpresses the Sema3D protein (truncated at cleavage site P3; ie, long), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertSema3d (Sema3d Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema5a-AP-His
Plasmid#72035PurposeExpresses the extracellular region of the Sema5A protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertSema5a (Sema5a Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pENTR4_FLAG/HA_FUS_His6
Plasmid#26365DepositorInsertFUS (FUS Human)
UseEntry vectorTagsFLAG/HA and His6ExpressionMutationdelta 527 (stop codon)PromoterAvailable sinceOct. 18, 2010AvailabilityAcademic Institutions and Nonprofits only -
pTRCHisB-TRF2∆B
Plasmid#53208PurposeExpressed N-terminally Hexahistine tagged TRF2 Delta Basic proteinDepositorInsertTRF2 Delta Basic (TERF2 Human)
UseTags6x HisExpressionBacterialMutationcontains amino acids 47-500PromoterTrcAvailable sinceJune 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
Sema4b-Fc-His
Plasmid#72155PurposeExpresses the extracellular region of the Sema4B protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertSema4b (Sema4b Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
Nrp1-AP-His
Plasmid#71971PurposeExpresses the extracellular region of the Neuropilin 1 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertNrp1 (Nrp1 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBS-Histone H1
Plasmid#45083DepositorInsertHistone H1
UseRNAi; In vitro transcriptionTagsExpressionMutationPromoterT7 sense, T3 antisenseAvailable sinceJune 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
SPOCK1_23-439_HisN_AviC
Plasmid#195876PurposeBaculovirus expression for structure determination; may not be full ORFDepositorInsertSPOCK1 (SPOCK1 Human)
UsePfhmsp-avic-lic-n, baculovirus expressionTagsExpressionMutationPromoterPolyhedrinAvailable sinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
Plxnb3-Fc-His
Plasmid#72130PurposeExpresses the extracellular region of the PlexinB3 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertPlxnb3 (Plxnb3 Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceMarch 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET3_HMV-His6
Plasmid#164843PurposeExpression of FL human metavinculinDepositorInsertVCL (VCL Human)
UseTagsHis6ExpressionBacterialMutationPromoterAvailable sinceFeb. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
Sema3f(S, +)-AP-His
Plasmid#72023PurposeExpresses the Sema3F protein (truncated at cleavage site P1; ie, short and contains no deletion in exon 3), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertSema3f (Sema3f Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pST50Trc1-HISDHFR
Plasmid#63935PurposePosition 1 transfer plasmid for pST44 polycistronic plasmid suite; N-term non-cleavable single tag; contains DHFR gene in BamHI-NgoMIV cassette as positive controlDepositorTypeEmpty backboneUseTags6xHisExpressionBacterialMutationPromoterT7Available sinceAug. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
Flrt1-AP-His
Plasmid#71947PurposeExpresses the extracellular region of the FLRT1 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertFlrt1 (Flrt1 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceJan. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ncam1_0.0.0-Fc-His
Plasmid#72086PurposeExpresses the extracellular region of the NCAM1, isoform 0.0.0 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertNcam1_0.0.0 (Ncam1 Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceMay 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
Cntn4.2-AP-His
Plasmid#71942PurposeExpresses the entire Contactin 2, isoform 2 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertCntn4.2 (Cntn4 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only