We narrowed to 14,145 results for: TIM
-
Plasmid#79596PurposeTransient and retroviral expressionDepositorAvailable SinceAug. 17, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pX458-GFP-TRIM28
Plasmid#185010PurposeEncodes gRNA for mouse TRIM28 along with Cas9 with 2A-EGFPDepositorInsertTRIM28 sgRNA (Trim28 Mouse)
UseCRISPRAvailable SinceJune 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCYC1pr-GNSI (LEU)
Plasmid#111450PurposeGNSI is a synthetic, genetically-encoded reporter that allows rapid plate-based assessment of AP-3 functional deficiency, using either colorimetric or growth phenotype readouts.DepositorInsertsCYC1 Promoter (CYC1 Budding Yeast)
Nyv1 Cytosolic Domain (aa 6-230)
Snc1 Transmembrane Domain (TMD)
SUC2 CDS
SUC2 terminator
TagsmGFP5ExpressionYeastMutationM109I (Naturally occurring SNP) and The first 21 …Available SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pB80-iLID-mCherry-RAB11
Plasmid#174623PurposeOptogenetic coupling to recycling endosomes (RAB11) via iLIDDepositorInsertiLID-mCherry-RAB11 (RAB11A Human, Synthetic)
TagsiLID-mCherryExpressionMammalianMutationmCherry: Met1Del; RAB11: Met1DelPromoterChicken beta-actinAvailable SinceOct. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
FKBP-Stx4-mCitrine
Plasmid#92427PurposeExpression of syntaxin-4 N-terminally conjugated to FKBP and C-terminally conjugated to mCitrine.DepositorInsertStx4 (Stx4 Rat)
TagsFKBP (FK506 binding protein 12); allows for heter…ExpressionMammalianPromoterCMVAvailable SinceJuly 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001147780)
Plasmid#80226Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEN_TT JunD-HA
Plasmid#58498PurposeGateway entry vector for an inducible HA-tagged mouse JunDDepositorAvailable SinceSept. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
2xNLS-NLP-cMyc LbaCas12a
Plasmid#182123PurposepET21a protein expression vector for 2xNLS-NLP-cMyc LbaCas12a in bacteriaDepositorInsert2xNLS-NLP-cMyc LbaCas12a
Tags6xHisExpressionBacterialPromoterT7Available SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
7432 Bicistronic_GFP_ires_puro
Plasmid#64336PurposeThis a retroviral expression plasmid expressing GFP along with puro resistance geneDepositorInsertGFP
UseRetroviralTagsGFPAvailable SinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
WEE1 gRNA (BRDN0001149349)
Plasmid#77367Purpose3rd generation lentiviral gRNA plasmid targeting human WEE1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIM1 gRNA (BRDN0001146465)
Plasmid#77174Purpose3rd generation lentiviral gRNA plasmid targeting human PIM1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIM1 gRNA (BRDN0001146597)
Plasmid#77175Purpose3rd generation lentiviral gRNA plasmid targeting human PIM1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIM1 gRNA (BRDN0001145078)
Plasmid#77176Purpose3rd generation lentiviral gRNA plasmid targeting human PIM1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSW002-PpsbA-mNeonGreen
Plasmid#205017PurposeBroad host-range bacterial expression vector with constitutive PsbA promoter; mNeonGreen (codon optimized for P. fluorescens)DepositorInsertmNeonGreen
ExpressionBacterialMutationmNeonGreen is codon optimized for expression in P…PromoterPpsbAAvailable SinceSept. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET28a-HsSENP6
Plasmid#71469PurposeEncodes human full length SENP6 optimised for E. coli expression. Suitable for in vitro transcription/translation (T7).DepositorInsertSUMO1/sentrin specific peptidase 6 (SENP6 Human)
TagsHexahistidineExpressionBacterialMutationGene optimised for E. coli expression (Genscript)PromoterT7Available SinceDec. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
ROCK1 gRNA (BRDN0001147709)
Plasmid#77593Purpose3rd generation lentiviral gRNA plasmid targeting human ROCK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001145869)
Plasmid#80256Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
WEE1 gRNA (BRDN0001145570)
Plasmid#77368Purpose3rd generation lentiviral gRNA plasmid targeting human WEE1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV10-Flag-Fbxl3
Plasmid#48751PurposeExpression of FLAG-tagged Fbxl3DepositorAvailable SinceDec. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCDNA-hNgAgo
Plasmid#104384Purposehuman codon optimized NgAgo; pCDNA3 vector backbone, mammalian expressionDepositorInserthNgAgo
Tags3XFlag, Nucleoplasmin NLS, and SV40 NLSExpressionMammalianPromoterCMVAvailable SinceApril 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV dCas9-MC (eGFP)
Plasmid#89931PurposeExpresses the dCas9-MC fragment only of the sMTase system for targeted DNA methylation in mammalian cells. Contains a eGFP marker expressed off separate promoter.DepositorInsertdCas9-MC
TagsFlagExpressionMammalianMutationdeactivated Cas9, fragment of M.SssI (residues 27…PromoterCMVAvailable SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
PLK1 gRNA (BRDN0001145759)
Plasmid#76457Purpose3rd generation lentiviral gRNA plasmid targeting human PLK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUC19-G2ZYP2
Plasmid#103110PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertG2ZYP2(Cas9 coding gene from Ralstonia syzygii R24)
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
ROCK1 gRNA (BRDN0001145904)
Plasmid#77594Purpose3rd generation lentiviral gRNA plasmid targeting human ROCK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUC19-Q927P4
Plasmid#103131PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertQ927P4(Cas9 coding gene from Listeria innocua serovar 6a (strain CLIP 11262))
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEX-C/EBPbZIP (pGEX-bZIPa)
Plasmid#12435DepositorAvailable SinceJan. 4, 2007AvailabilityAcademic Institutions and Nonprofits only -
ROCK1 gRNA (BRDN0001146798)
Plasmid#77595Purpose3rd generation lentiviral gRNA plasmid targeting human ROCK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PLK1 gRNA (BRDN0001144995)
Plasmid#76459Purpose3rd generation lentiviral gRNA plasmid targeting human PLK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRTTO-NHASt-codoptUS2
Plasmid#135102PurposeCodon-optimized HSV-1 US2 with N-terminal HAStrep tagDepositorInsertHSV-1 US2 codon optimized
TagsHA-Strep-StrepExpressionMammalianAvailable SinceJan. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-sbGLuc-CheRiff-EGFP
Plasmid#114108Purposefusion protein of Gaussia luciferase variant slow burn, synthetic channelrhodopsin CheRiff, and enhanced green fluorescent protein for bioluminescent optogeneticsDepositorInsertGaussia luciferase, slow burn; CheRiff synthetic ChR; EGFP
UseAAVExpressionMammalianPromoterhSynAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001146709)
Plasmid#80240Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pETDuet-1-6xHis-TEV-Nsp8
Plasmid#201022PurposeBacterial expression of codon optimized SARS-CoV-2 nsp8 tagged with an N-terminus His-tag followed by a TEV protease cleavage site.DepositorInsertnon-structural protein 8 (ORF1ab Severe acute respiratory syndrome coronavirus 2, Synthetic)
Tags6xHis-TEVExpressionBacterialMutationGene insert is codon optimized for Ecoli.PromoterT7/LacOAvailable SinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR SV40-hCas9 L3-L2
Plasmid#62133PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing SV40 promoter and human codon optimized Cas9 module. Compatible with MultiSite Gateway cloningDepositorInserthuman codon optimized Cas9
UseCRISPR; Mule gateway entry vectorExpressionMammalianPromoterSV40Available SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
PLK1 gRNA (BRDN0001144743)
Plasmid#76458Purpose3rd generation lentiviral gRNA plasmid targeting human PLK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-BAP-Sox2
Plasmid#133281PurposeExpression of target proteins BAP-Sox2 in mammalian cellsDepositorInsertSox2 (SOX2 Human)
TagsBiotin Acceptor Peptide contains 7-His-tagExpressionMammalianPromoterCMVAvailable SinceJan. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLK1 gRNA (BRDN0001147678)
Plasmid#76460Purpose3rd generation lentiviral gRNA plasmid targeting human PLK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLNCX2-mCherry-CHMP2A-siRNAres
Plasmid#115332Purposeexpresses siRNA-resistant mCherry-CHMP2A in mammalian cellsDepositorInsertCHMP2A (CHMP2A Human)
UseRetroviralTagsmCherryExpressionMammalianMutationmutated to be resistant to siRNA knockdownPromoterCMVAvailable SinceSept. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pAct-AtINT4
Plasmid#127530PurposePlasmid encodes A. thaliana codon optimized Integrase 4.DepositorInsertIntegrase 4 coding sequence codon optimized for A. thaliana expression.
ExpressionPlantAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
FLAG-HA-FbxO10-pcDNA3.1-
Plasmid#52508Purposeexpresses human FbxO10 in mammalian cells with FLAG-HA tag at N-terminusDepositorAvailable SinceJuly 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
PIP5K1A gRNA (BRDN0001147757)
Plasmid#77963Purpose3rd generation lentiviral gRNA plasmid targeting human PIP5K1ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIP5K1A gRNA (BRDN0001147420)
Plasmid#77964Purpose3rd generation lentiviral gRNA plasmid targeting human PIP5K1ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIP5K1B gRNA (BRDN0001147624)
Plasmid#77083Purpose3rd generation lentiviral gRNA plasmid targeting human PIP5K1BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PTK6 gRNA (BRDN0001149364)
Plasmid#76490Purpose3rd generation lentiviral gRNA plasmid targeting human PTK6DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ADCK4 gRNA (BRDN0001145019)
Plasmid#76560Purpose3rd generation lentiviral gRNA plasmid targeting human ADCK4DepositorInsertADCK4
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCNL-C1_fibrillarin
Plasmid#65709PurposeExpresses CNL-fibrillarin in mammalian cellsDepositorAvailable SinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET-dHeFSpCas9-VP64-6xHis
Plasmid#92119PurposeExpression of dead/inactive increased fidelity HeFSpCas9-VP64-6xHis in bacterial cellsDepositorInsertdead/inactive HeFSpCas9-NLS-3xFLAG-VP64
UseCRISPRTags3xFLAG, 6xHis, NLS, and VP64ExpressionBacterialMutationD10A, N497A, R661A, Q695A, H840A, K848A, Q926A, K…PromoterT7Available SinceOct. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001145269)
Plasmid#80249Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
ROCK2 gRNA (BRDN0001146481)
Plasmid#76350Purpose3rd generation lentiviral gRNA plasmid targeting human ROCK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
sTR056
Plasmid#177369PurposeToehold switch, with an unpaired toehold region at the 5′-end that interacts with the trigger RNA (sTR060, Addgene plasmid # 177370) to unfold the switch.DepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only