We narrowed to 11,576 results for: Kars
-
Plasmid#193194PurposeExpress Caspase conditional upon RNA transcriptDepositorInsertiCaspase9 (CASP9 Human)
ExpressionMammalianAvailable SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHEN-CoV2-nanobody-G6
Plasmid#194589PurposeBacterial expression of G6 nanobody targeting the receptor binding domain (RBD) of SARS-CoV-2 spikeDepositorInsertG6 (S )
ExpressionBacterialAvailable SinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
PRPF19
Plasmid#155847PurposeFor use in RBP tethering screenDepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
OMM-long-CFAST10
Plasmid#233598PurposeExpression of CFAST10 on the OMM membrane after a long linkerDepositorInsertCFAST10
ExpressionMammalianPromoterCMVAvailable SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAF0362 Ef1a-Cp36_attP-Puro-p2a-mCherry donor
Plasmid#193469PurposeCp36 Donor with promoter for mcherry and puro expressionDepositorInsertCp36_attP
ExpressionMammalianAvailable SinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET14b His Rab8a Q67L
Plasmid#186014PurposeHis Rab8a Q67LDepositorInsertHis Rab8a Q67L (RAB8A Human)
ExpressionBacterialAvailable SinceSept. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
PRPF3
Plasmid#155848PurposeFor use in RBP tethering screenDepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDF0114 pU6-Eco31i-Eco31i-DisCas7-11 mature DR guide scaffold with golden gate site
Plasmid#172508PurposeEncodes the mature DisCas7-11 DR along with a golden gate site for spacer cloningDepositorInsertpU6-Eco31i-Eco31i-DisCas7-11 mature DR guide scaffold with golden gate site
ExpressionMammalianAvailable SinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
Plenti-ARE-HSVTK-luc
Plasmid#161789PurposeExpresses HSV-TK and Luciferase in an NRF2 dependent manner. Also, expresses cherry and blasticidin resistance selection markersDepositorInsertsLuciferase-T2A-HSV-TK
mCherry P2A blasticidin
UseLentiviral and LuciferaseExpressionMammalianPromoterEF1a and Murine Gclc AREAvailable SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDF0338 pAAV U6-HvsCas7-11 DR Rev-BpiI golden gate backbone dual vector
Plasmid#172514PurposeEncodes HvsCas7-11 DR and golden gate site for spacer clonings in an AAV backbone with U6 promoterDepositorInsertpAAV U6-HvsCas7-11 DR Rev-BpiI golden gate backbone dual vector
UseAAVAvailable SinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
SERPINH1
Plasmid#155999PurposeFor use in RBP tethering screenDepositorAvailable SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynapFLEX.(mem).iGlucoSnFR2.mIRFP670nano3
Plasmid#244102PurposePlasma membrane targeted expression of green glucose sensor with non-responsive mIRFPDepositorInsertiGlucoSnFR2.mIRFP670nano3
UseAAVTagsIgG kappa leader and mIRFP670nano3Available SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
HA-SOCS1
Plasmid#174571PurposeHuman HA-tagged SOCS1 expression (N-term. tag) (CMV prom.)DepositorInsertHA-SOCS1
ExpressionMammalianPromoterCMVAvailable SinceJan. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
Venus-G protein Beta2 in pcDNA3.1
Plasmid#42182DepositorAvailable SinceJuly 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-Flag-cMyc T58A
Plasmid#20075DepositorAvailable SinceJan. 9, 2009AvailabilityAcademic Institutions and Nonprofits only -
pUC19-dual-scafffold-2.0 (pBP49)
Plasmid#218931PurposeThe dual-scaffold for making dual-CRISPR screening libraries or dual-CRISPR plasmids.DepositorInsertdual scaffolds for CRISPR
UseCRISPRAvailable SinceJuly 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-Guide-BSD
Plasmid#216123PurposeMakes CRISPR gRNAs detectable by single-cell RNA-seq. The gRNA is expressed as part of the blasticidin resistance mRNA transcribed by RNA Pol II and in its functional form from the hU6 promoter.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR36(DjCas13d-SapI)-CMV-intron-MCS-pA
Plasmid#233031PurposeTo express a DjCas13d-compatible gRNADepositorInsertDjCas13d-compatible gRNA expression cassette
UseAAVAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-CasRx-P2A-mCherry-pA
Plasmid#233025PurposeTo Express HA tagged CasRX and mcherry from the mammalian EFS promoter. The CasRx and mCherry are separated by a P2A siteDepositorInsertCasRx/mCherry
UseAAVTagsmCherryAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap.(cyto).iGlucoSnFR2.HaloTag
Plasmid#244094PurposeCytosolic expression of green glucose sensor with non-responsive HaloTagDepositorInsertiGlucoSnFR2.HaloTag
UseAAVTagsHaloTagAvailable SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap.(cyto).iGlucoSnFR2.H348H.HaloTag
Plasmid#244095PurposeCytosolic expression of green glucose sensor (high affinity) with non-responsive HaloTagDepositorInsertiGlucoSnFR2.H348H.HaloTag
UseAAVTagsHaloTagAvailable SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA251_ Ptrc.x.tetO2::D-HicDH
Plasmid#185456PurposeCDS of D-HicDH codon optimized for expression in Synechocystis sp. PCC 6803 under the control of the synthetic promoter Ptrc.x.tetO2 and the RBS BBa_B0030 in pSEVA251 plasmid.DepositorInsertD-HicDH from Lactobacillus paracasei DSM 20008
ExpressionBacterialPromoterPtrc.x.tetO2Available SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
SNW1
Plasmid#156034PurposeFor use in RBP tethering screenDepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-dual-CRISPR-U6-H1(pBP43)
Plasmid#218930PurposeThe backbone lentiviral dual-CRISPR plasmid for making the dual-CRISPR screening libraries.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterhuman U6 and H1Available SinceJuly 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCB’ CbbL Y72R
Plasmid#162707PurposeCarboxysome operon with point mutation to CbbL, prk; Substitution of CsoS2-binding tyrosine with arginine prevents rubisco encapsulation creating rubisco-less carboxysomesDepositorInsertpHnCB10 derived carboxysome operon, prk
ExpressionBacterialMutationCbbL Y72R; Substitution of CsoS2-binding tyrosine…PromoterPLtet0-1 promoterAvailable SinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET15b+His SUMO PPM1H
Plasmid#207333PurposeBacterial expression of His SUMO PPM1HDepositorAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1A-LivePAR-Hygro
Plasmid#176063PurposeEGFP fused to the C-terminus of a WWE domain & a hygromycin resistance cassetteDepositorInsertLivePAR
UseLentiviralTagsEGFPExpressionMammalianPromoterEF1AAvailable SinceJan. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTH727-CEN-RLuc/staCFLuc
Plasmid#38211DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationThe last three codons of the full-length Firefly …PromoterADH1 and TDH3 (=GPD)Available SinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCF1148
Plasmid#222330PurposeFluorescent reporter plasmid for VeillonellaDepositorInsertbs2 gene with Veillonella parvula SKV38 mdh promoter
UseE. coli-veillonella shuttle plasmidExpressionBacterialPromoterVeillonella parvula SKV38 mdh promoterAvailable SinceOct. 31, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
EF1a_MYCN_P2A_Hygro_Barcode
Plasmid#120463PurposeBarcoded lentiviral vector to express MYCN in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
PP_071_pAAV_CAG_DIO-LR-Voltron2-P2A-LR-CheRiff-TS-eYFP-ER2
Plasmid#203229PurposeCre-dependent version of PP_070. Co-expressing membrane-localized Voltron2 and membrane-localized CheRiff.DepositorInsertCre-dependent, membrane-localized Optopatch
UseAAVExpressionMammalianPromoterCAGAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTET2-lucCP-3MS2
Plasmid#198351PurposePart of Firefly reporter system, encodes Firefly luciferase with MS2 stem loops in the 3'UTRDepositorInsertFirefly Luciferase
UseLuciferaseExpressionMammalianPromoterpTET2Available SinceApril 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBMN_HA-TBK1 (kinase dead - D135N)
Plasmid#199206PurposeUsed for the expression of TBK1 carrying a kinase dead mutation D135N (SMC Internal No. 1997)DepositorAvailable SinceMay 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHEN-CoV2-nanobody-C7
Plasmid#194591PurposeBacterial expression of C7 nanobody targeting the receptor binding domain (RBD) of SARS-CoV-2 spikeDepositorInsertC7 (S )
ExpressionBacterialAvailable SinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pUB-HspINTphiC31
Plasmid#127518PurposePlasmid encodes H. sapiens codon optimized Integrase phiC31.DepositorInsertIntegrase phiC31 coding sequence codon optimized for H. sapiens expression.
ExpressionMammalianAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
plenti-UbcP-HA-CRBN-pGK-HYG
Plasmid#107378PurposeLentiviral expression of HA-CRBNDepositorAvailable SinceJune 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
TetO-FUW-Lhx2
Plasmid#61537PurposeExpresses Lhx2 in mammalian cellsDepositorAvailable SinceJan. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
Intron-Tagging-EGFP-Frame0-Parental-Minicircle
Plasmid#216124PurposeParental minicircle containing EGFP flanked by a splice acceptor and splice donor. Used with other intron tagging plasmids for placing the EGFP tag as a synthetic exon into frame 0 introns of target genes.DepositorInsertsgRNA-SA-(GGGGS)x4-EGFP-(GGGGS)x4-SD
UseCRISPRAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
PRPF4
Plasmid#155850PurposeFor use in RBP tethering screenDepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHS1950
Plasmid#205983PurposeGa0116245_10002768 T7/LacO-Cas6 + TwinStrep-Cas14 + Cas7 + His14-Cas5::pJ23119-DR-Fn spacer-DRDepositorInsertsGa0116245_10002768 candidate type VII proteins
Cas14
Cas5
CRISPR array
Tags14xHis and TwinStrep-tagExpressionBacterialPromoterT7 (proteins), pJ23119 (crRNA)Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.(mem).iGlucoSnFR2.mRuby3
Plasmid#244075PurposePlasma membrane targeted expression of green glucose sensor with non-responsive mRuby3DepositorInsertiGlucoSnFR2.mRuby3
UseAAVTagsIgG kappa leader and mRuby3Available SinceOct. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
OMM-short-CFAST10
Plasmid#233597PurposeExpression of CFAST10 on the OMM membrane after a short linkerDepositorInsertCFAST10
ExpressionMammalianPromoterCMVAvailable SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTCB-nivoHCLALAPGknobHA
Plasmid#237377PurposepTwist CMV BetaGlobin encoding nivolumab heavy chain with LALA P329G knob Fc and HA tagDepositorInsertnivolumab heavy chain (silent Fc)
TagsHAExpressionMammalianPromoterCMVAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTCB-nivoLC
Plasmid#237378PurposepTwist CMV BetaGlobin encoding nivolumab light chainDepositorInsertnivolumab light chain
ExpressionMammalianPromoterCMVAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTCas9_scr
Plasmid#207566PurposeThermoCas9-mediated cleavage of genomic DNA in E. coliDepositorInsertPlac/tet_ThermoCas9_PlacI_lacI_PJ23119_sgRNA(scrambled non-targeting spacer)
ExpressionBacterialMutationWild-typeAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
EXT1-pLJC2-3XFLAG
Plasmid#215818PurposeEctopic expression of EXT-1 in mammalian cellsDepositorInsertExostosin glycosyltransferase 1 (EXT1 Human)
UseLentiviralTags3X FlagExpressionMammalianAvailable SinceMarch 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSMP-DNMT1_1
Plasmid#36382DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTet-O-NEUROD1-T2A-PuroR
Plasmid#162338PurposeLentiviral expression of NEUROD1 under the control of the TetON promoterDepositorAvailable SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only