We narrowed to 6,371 results for: KIT;
-
Plasmid#61248PurposeExpresses REX-GECO1 in neuronsDepositorInsertREX-GECO1
UseAAVExpressionMammalianMutationSubstitutions relative to R-GECO1: P60R, V61W, R6…PromoterhSynAvailable SinceMarch 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET24a-VHH-2xTS
Plasmid#109419PurposeBacterial expression of a functionalized anti-GFP (VHH) nanobody fused to two tyrosine sulfation (TS) motifs. VHH-2xTS also contains a T7, HA, BAP and His6 epitopeDepositorInsertanti-GFP nanobody fused to a T7, TS, HA, BAP and His6 epitope
TagsBAP, HA, His6, T7, and Tyrosine sulfation (TS) se…ExpressionBacterialPromoterT7Available SinceJune 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS5
Plasmid#170856PurposeAAV backbone for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of any transgene in neurons under the control of the hSyn1 promoter.DepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS416d
Plasmid#87386PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJW2072
Plasmid#154334PurposeCrispr repair template: add insertion site specific homology arms by PCR before insertionDepositorInsert30aa linker::mScarlet-I (dpi)::3xMyc::10aa linker
UseCRISPRExpressionWormMutationSilent mutations to remove piRNA sitesAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-TagRFP658-P2A-GFP
Plasmid#178971PurposeExpresses TagRFP658 and GFP in mammalian cellsDepositorInsertTagRFP658-P2A-GFP
UseAAVExpressionMammalianPromoterCAGAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
MAC-CLEC4E
Plasmid#172412PurposeMAC-tagged gene expressionDepositorInsertC-type lectin domain family 4 member E (CLEC4E Human)
TagsMAC-tagExpressionMammalianPromoterCMV promoterAvailable SinceNov. 4, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-VTKD5-GCaMP6f
Plasmid#178728PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of GCaMP6f in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertGCaMP6f
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
pSLPB2-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin
Plasmid#187945PurposedCas9 fused with tagRFPt, P2A site and tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertSpdCas9-tagRFPt-P2A-tagBFP
UseSynthetic Biology; PiggybacTagsNLS, NLS + HA-tag, P2A, tagBFP, and tagRFPtExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS5-GFP
Plasmid#178713PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of GFP in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertGFP
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS6-GFP
Plasmid#178714PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of GFP in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertGFP
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD4-dTom
Plasmid#178715PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of dTom in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertdTom
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-2xLyn-ERex-Venus(Y145W)-bPAC(F198Y)
Plasmid#165493PurposeNeuronal expression of PACmn with dark Venus, a photoactivatable adenylyl cyclase derived from bPAC, membrane-anchored, no/reduced dark activityDepositorInsert2xLyn-ERex-Venus(Y145W)-bPAC(F198Y)
UseAAVTagsdarkVenusExpressionMammalianPromoterCaMKIIAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS106a
Plasmid#87382PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS106a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pOD2087-trnDEG
Plasmid#89369PurposeMosSCI targeting vector expressing a fusion between a GFP nanobody and an ubiquitin ligase adaptor ZIF-1 to degrade GFP tagged proteins. Expression is controlled by Pmec-18 (touch neuron specific).DepositorInsertvhhGFP4-ZIF-1 (zif-1 Nematode, Synthetic)
UseTargeting vector for mos1 transposon mediated sin…TagsvhhGFP4 (GFP nanobody)PromoterPmec-18Available SinceJune 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBacMam2-DiEx-LIC-C entry vector
Plasmid#111752PurposeIntermediate vector containing HTT gene, except for polyQ region. Used to clone various polyQ lengths into HTT sequence with C-term FLAG tag. Baculovirus transfer vector for insect and mammalian cellsDepositorTypeEmpty backboneUseBaculovirus expressionTagsFLAGExpressionMammalianAvailable SinceNov. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1114a
Plasmid#87397PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1114a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS308a
Plasmid#87384PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD5
Plasmid#170850PurposeAAV backbone for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of any transgene in cortical interneurons under the control of the Dlx enhancer.DepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD6
Plasmid#170851PurposeAAV backbone for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of any transgene in cortical interneurons under the control of the Dlx enhancer.DepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJH126
Plasmid#162482PurposeSEC plasmid containing LG1 homology arms and vha-8p::TIR1::F2A::BFP::AID*::NLS::tbb-2 3'UTR, for expression of TIR1 and nuclear BFP reporter in C. elegans.DepositorInsertvha-8p::TIR1::F2A::AID*::NLS::tbb-2 3'UTR
UseCRISPRTagsvha-8p::TIR1::F2A::AID*::NLS::tbb-2 3'UTRExpressionWormAvailable SinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS4-GCaMP6f
Plasmid#178730PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of GCaMP6f in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertGCaMP6f
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1309a
Plasmid#87399PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1309a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD6-dTom
Plasmid#178717PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of dTom in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertdTom
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1622b
Plasmid#87403PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1622b sequence GTCACGTTCCTGAGGTTACT in yeast chromosome 16.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1622b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS5-dTom
Plasmid#178719PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of dTom in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertdTom
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS6-dTom
Plasmid#178720PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of dTom in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertdTom
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS4-GFP
Plasmid#178712PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of GFP in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertGFP
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS911b
Plasmid#87394PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS911b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-2xLyn-ERex-Venus(Y145W)-bPAC(F198Y)
Plasmid#165492PurposeNeuronal expression of PACmn with dark Venus, a photoactivatable adenylyl cyclase derived from bPAC, membrane-anchored, no/reduced dark activityDepositorInsert2xLyn-ERex-Venus(Y145W)-bPAC(F198Y)
UseAAVTagsdarkVenusExpressionMammalianPromoterhSyn1Available SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
pSN672
Plasmid#177362PurposeExpresses human KIF1A(1-393) fused with leucine zipper and His tagDepositorAvailable SinceAug. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
-
pJW1927
Plasmid#163093PurposeCRISPR repair template: add insertion site specific homology arms by PCR before insertionDepositorInsertmScarlet-I^SEC (Lox511I)^TEV::AID*::3xFLAG
UseCRISPR and Cre/LoxExpressionWormAvailable SinceJan. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUDR217
Plasmid#113872Purposeexpression of Cas9 programming sgRNA9 and sgRNA10 targetting MPH2-3 and MAL11 respectivelyDepositorInsertsgRNA9-MPH2-3 sgRNA10-MAL11
UseCRISPRExpressionYeastAvailable SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-REX-GECO0.9
Plasmid#61249PurposeExpresses REX-GECO0.9 in neuronsDepositorInsertREX-GECO0.9
UseAAVExpressionMammalianMutationSubstitutions relative to R-GECO1: P60R, V61W, R6…PromoterhSynAvailable SinceMarch 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pURD214
Plasmid#113871Purposeexpression of Cas9 programming sgRNA5 and sgRNA2 targetting HXT13-15-16 and HXT2 respectivelyDepositorInsertsgRNA5 HXT13-15-16 sgRNA2-HXT2
UseCRISPRExpressionYeastAvailable SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only