We narrowed to 8,660 results for: gal
-
Plasmid#125223Purpose3xHA-V5 tagged RpL10Ab for expression from UAS promoter to TRAP translatome from specific cell types defined by GAL4 expressionDepositorAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pcDNA5 FRT TO GFP hBub1 K821R
Plasmid#59813PurposeAllows the integration of GFP hBub1 K821R in the genome and Tet-inducible expression.DepositorInsertBub1 (BUB1 Human)
TagsEmGFPExpressionMammalianMutationK821RPromoterhybrid human cytomegalovirus (CMV)/TetO2 promoterAvailable SinceFeb. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT TO GFP hBub1 WT
Plasmid#59812PurposeAllows the integration of GFP hBub1 in the genome and Tet-inducible expression.DepositorInsertBub1 (BUB1 Human)
TagsEmGFPExpressionMammalianPromoterhybrid human cytomegalovirus (CMV)/TetO2 promoterAvailable SinceFeb. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUAST cyto Grx1-roGFP2
Plasmid#64994Purposefor expression of cytosolic Grx1-roGFP2 with the Gal4 expression system in drosophilaDepositorAvailable SinceJuly 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGEN25-Ub Hs
Plasmid#83232PurposepHis-par2-Ub HsDepositorAvailable SinceNov. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAd5-Blue
Plasmid#174431PurposepAd5-Blue provides a platform for the rapid construction of recombinant and replication defective Adenovirus. This vector contains unique restriction enzyme sites to allow cloning of a gene.DepositorInsertβ-galactosidase α gene fragment
UseAdenoviralExpressionMammalianPromoterCMVAvailable SinceMay 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV CAG ChR2 E123T T159C 2A tDimer
Plasmid#85399PurposeHigh efficiency channelrhodopsin with cytomegalovirus enhancer fused to chicken β-actin (CAG) promoterDepositorInsertsChannelrhodopsin-2
red fluorescent protein
UseAAVExpressionMammalianMutationE123T , T159CPromoterCAG and ribosomal skip sequence 2AAvailable SinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
UAS-dsarm(E)
Plasmid#187870PurposeGal4/UAS expression of dSarm(isoE)DepositorInsertdSarm isoform E (Sarm Fly)
Available SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYB-Dual(mNG(yeast-opt))
Plasmid#216727PurposeDual-species protein expression vector for high-level and inducible protein expression of mNeonGreen (codon optimized for yeast) in both yeast and bacteria from the same construct.DepositorInsertmNeonGreen
ExpressionBacterial and YeastPromoterpGAL1(yeast) and pT7-RNAP(bacteria)Available SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT TO Myc ArC Long WT
Plasmid#59809PurposeAllows the integration of Myc ArC Long in the genome and Tet-inducible expression.DepositorInsertAurora C (AURKC Human)
TagsMycExpressionMammalianPromoterhybrid human cytomegalovirus (CMV)/TetO2 promoterAvailable SinceFeb. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCRI009-pKW20088-PelcA-mCherry-TtrpC-NotI-PacI
Plasmid#140202PurposeCRISPRa proof-of-concept test target with fluorescent reporter. PelcA is fused to mCherry, with low basal expression in Aspergillus nidulans. Fungal vector with AMA1 and pyrG selection marker.DepositorInsertmCherry
UseCRISPR and Synthetic Biology; Proof-of-concept te…MutationG174DPromoterPelcAAvailable SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUAST mito roGFP2-Grx1
Plasmid#64995Purposefor expression of mitochondrial roGFP2-Grx1 with the Gal4 expression system in drosophilaDepositorInsertGlutaredoxin-1 (GLRX Human)
TagsroGFP2ExpressionInsectMutationmitochondrial targeting sequenceAvailable SinceJuly 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJEP307-pAAV-EFS(No AgeI)-MCS3-pA
Plasmid#113684PurposeEFS driven Multi Cloning Site-3 without the AgeI restriction enzyme site.DepositorInsertN/A
UseAAVPromoterCytomegalo Virus(CMV)Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSc-His6-Sem1Sc
Plasmid#83235PurposepGREG600-His6-Sem1Sc, Expresses the His6-Sem1 in yeastDepositorAvailable SinceNov. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJS699
Plasmid#168779PurposeEncodes the SARS-CoV-2 Spike Receptor Binding Domain (RBD) and can be combined with pJS697 through homologous recombinationDepositorAvailable SinceAug. 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRI008-PgpdA-Cas12aScaffold-BsmbI-Cas12aScaffold-TrcpT
Plasmid#140201PurposeFungal vector for one-step cloning of LbCas12a crRNA arrays and expression. Pgpda and pyroA are BsmbI domesticated.DepositorTypeEmpty backboneUseCRISPR and Synthetic Biology; Cloning of crrna an…TagsdLbCas12a crRNA scaffoldPromoterPgpdAAvailable SinceSept. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
p1193-scAAV-U6-sgRNA_Nme2Cas9_Rosa26-CB-PI-AcrIIC3Nme_FLAG_NLS-3XmiR122BS
Plasmid#129531PurposeSelf-complementary AAV vector expressing Nme2Cas9 sgRNA targeting Rosa26 and AcrIIC3Nme with 3x miR-122 binding sites in 3' UTRDepositorInsertscodon-optimized AcrIIC3Nme
sgRNA_Rosa26
UseAAVTagsFLAG/NLSPromoterU6 and cytomegalovirus-enhancer chicken β-actin p…Available SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT TO myc Separase S1226A/ C2029A
Plasmid#59823PurposeAllows the integration of myc Separase S1226A/ C2029A in the genome and Tet-inducible expression.DepositorInsertSeparase (ESPL1 Human)
TagsMycExpressionMammalianMutationS1226A/ C2029APromoterhybrid human cytomegalovirus (CMV)/TetO2 promoterAvailable SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT TO myc p31Comet
Plasmid#59833PurposeAllows the integration of myc p31Comet in the genome and Tet-inducible expression.DepositorInsertp31 (MAD2L1BP Human)
TagsMycExpressionMammalianPromoterhybrid human cytomegalovirus (CMV)/TetO2 promoterAvailable SinceFeb. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT TO myc Separase delta 55/S1126A
Plasmid#59825PurposeAllows the integration of myc Separase delta 55/S1126A in the genome and Tet-inducible expression.DepositorInsertSeparase (ESPL1 Human)
TagsMycExpressionMammalianMutationdelta 55/S1126APromoterhybrid human cytomegalovirus (CMV)/TetO2 promoterAvailable SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT TO Myc ArC K72R
Plasmid#59811PurposeAllows the integration of Myc ArC K72R in the genome and Tet-inducible expression.DepositorInsertAurora C (AURKC Human)
TagsMycExpressionMammalianMutationK72R, kinase mutantPromoterhybrid human cytomegalovirus (CMV)/TetO2 promoterAvailable SinceFeb. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
Alt AlphaPS3
Plasmid#14070DepositorInsertDrosphila Alt Alpha PS3 Integrin (scb Fly)
ExpressionBacterialAvailable SinceMarch 2, 2007AvailabilityAcademic Institutions and Nonprofits only -
pEN_TmiR_G12-E
Plasmid#25761PurposeEntry vector with TRE promoter driving mouse G alpha 12 miR30-based shRNA.DepositorInsertG alpha 12 miR-shRNA (Gna12 Mouse)
UseEntry vectorAvailable SinceJuly 14, 2010AvailabilityAcademic Institutions and Nonprofits only -
pM-ErbB4-delta-kinase-PY3 mutant
Plasmid#17802DepositorInsertErbB4 (ERBB4 Human)
TagsGAL4-BDExpressionMammalianMutationCarboxy-terminal fragment, amino acids 988-1292, …Available SinceMay 9, 2008AvailabilityAcademic Institutions and Nonprofits only -
pYTRW14K_7G5
Plasmid#177283Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn5 with GmR and LacZDepositorInsertlacZ
UseSynthetic Biology; Yeast expression, tn5 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTag4C_Nrg1-GV-2HA
Plasmid#227104PurposeNrg1 protein for luciferase and barcode assaysDepositorAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
p426-Cup1p-FusionRed
Plasmid#188392PurposeCu2+-dependent expression of red fluorescent protein in yeast cellsDepositorInsertFusionRed
ExpressionYeastPromoterCUP1 promoterAvailable SinceApril 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
UAS-dsarm(E,K450R)
Plasmid#187881PurposeGal4/UAS expression of dSarm(isoE,K450R)DepositorInsertdSarm isoform E (Sarm )
MutationK450RAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pESC-LEU-IpgD
Plasmid#183672PurposeInducible Shigella flexneri IpgD for expression in yeastDepositorInsertIpgD
ExpressionYeastPromoterGAL1Available SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
S113
Plasmid#174551PurposeConstitutive PhCMV-driven mammalian expression vector of CDH-3-TF cassette (PhCMV-Gal4-mdm2-P2A-LD6-Rel65-pA)DepositorAvailable SinceOct. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
C0012m (lacI)_CD
Plasmid#66026PurposeMoClo Basic Part: CDS - Controller protein, lacI repressor (in concert with CAP, represses pLacI, R0010). Modified to fix illegal site. [C:C0012m:D]DepositorInsertTranscription factor
UseSynthetic BiologyAvailable SinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGAD-hRubicon
Plasmid#64144PurposeFor yeast two hybridDepositorAvailable SinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT TO myc Separase delta 1278-1291
Plasmid#59830PurposeAllows the integration of myc Separase delta 1278-1291 in the genome and Tet-inducible expression.DepositorInsertSeparase (ESPL1 Human)
TagsMycExpressionMammalianMutationdelta 1278-1291Promoterhybrid human cytomegalovirus (CMV)/TetO2 promoterAvailable SinceFeb. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pM-ErbB4-delta-kinase-PY1 mutant
Plasmid#17801DepositorInsertErbB4 (ERBB4 Human)
TagsGAL4-BDExpressionMammalianMutationCarboxy-terminal fragment, amino acids 988-1292, …Available SinceMay 9, 2008AvailabilityAcademic Institutions and Nonprofits only -
Comp AlphaPS3
Plasmid#14071DepositorInsertDrosphila Comp Alpha PS3 Integrin (scb Fly)
ExpressionBacterialAvailable SinceMarch 2, 2007AvailabilityAcademic Institutions and Nonprofits only -
pAN1646
Plasmid#127205PurposepTet expression of Venus, Dual inducible expression of dCas9-VP64-mScarlet-degronSwitchA and KeyA-BFP-NLSDepositorInsertp7x_tet-Venus-tADH1-pGal1-dCas9-VP64-Linker-mScarlet-Linker-degronSwitch_A_t12-tPGK1-pZ3-key_A_e18-mTagBFP2-NLS(SV40)-tSSA1
UseSynthetic BiologyAvailabilityAcademic Institutions and Nonprofits only -
pBD-PYR1-DSM_Hao_library
Pooled Library#241289PurposeLibrary of pBD-PYR1 double site mutants for yeast-based screens; redesigned to remove constitutive mutants and wild type rceptorsDepositorExpressionYeastSpeciesArabidopsis thalianaAvailable SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
5HRE/GFP
Plasmid#46926Purposehypoxia-responsive enhanced green fluorescent protein (EGFP)-based systemDepositorInsert5X HRE of VEGF (VEGFA Human)
Tagsd2EGFPExpressionMammalianMutationfive copies of a 35-bp fragment from the hypoxia-…PromoterEF-1α promoterAvailable SinceAug. 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGST-DHFR Mm
Plasmid#83073PurposeExpresses the full length DHFR Mm in E.coliDepositorAvailable SinceNov. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
PD2529 human beta1 full
Plasmid#221401PurposeMammalian expression of human integrin beta1 full-lengthDepositorInsertintegrin beta1 full-length (ITGB1 Human)
TagsCD33 secretion peptide (MPLLLLLPLLWAGALA) and HA …ExpressionMammalianMutationcodon-optimized mature sequenceAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pB-Gaolf-Integration
Plasmid#129456PurposepiggyBac transposon vector that Inducibly (Tet-On) expresses GaolfDepositorAvailable SinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pME_Golgi-BFP_P2A_H2A_iRFP (JDW 1007)
Plasmid#224490PurposeGateway compatible middle entry clone containing GalT-mTagBFP-HA-P2A-H2A-iRFP (BFP golgi reporter and infrared RFP nuclear reporter)DepositorInsertGolgi-mTagBFP-P2A-H2A-iRFP
UseGateway cloningAvailable SinceOct. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEXPqcxip-hCCDC47-FLAG
Plasmid#159141PurposeHu CCDC47 -flag mammalian expression Gateway vector.DepositorInsertcoiled-coil domain containing 47 (CCDC47 Human)
UseRetroviralTagsFLAGExpressionMammalianPromoterCMV (cytomegalovirus) enhancer and the MSV (mouse…Available SinceMarch 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRRLNeo-pEF1a-p53ash-mCerulean
Plasmid#69579PurposeExpresses p53 tagged with mCeruleanDepositorInsertp53 (TP53 Human)
UseLentiviralTagsmCeruleanExpressionMammalianMutation7 silent mutations in p53 DNA to prevent targetin…PromoterEF1alphaAvailable SinceOct. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRRLHygro-pEF1a-p53ash-mKate2-splitmVenusC
Plasmid#69583PurposeExpresses p53 tagged with mKate2 and split C-term mVenusDepositorInsertp53 (TP53 Human)
UseLentiviralTagsmKate2 and split mVenus - C termExpressionMammalianMutation7 silent mutations in p53 DNA to prevent targetin…PromoterEF1alphaAvailable SinceNov. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr2-Gnaq
Plasmid#170298PurposeEncoding mouse GnaqDepositorInsertA recombinant mouse Gnaq (Gnaq Mouse)
TagsN/AExpressionMammalianMutationAsilent mutation was introduced into the sgRNA-ta…Available SinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX020
Plasmid#167146PurposeMoClo-compatible Level 0-CDS1 promoterless vector encoding Neonothopanus nambi caffeoylpiruvate nnCPH codon-optimised for expression in Nicotiana benthamianaDepositorInsertfungal caffeoylpiruvate hydrolase, nnCPH
UseSynthetic BiologyAvailable SinceJune 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
pAAV Syn hBE Rh Guanylyl Cyclase1 2A tDimer
Plasmid#66779PurposeThe rhodopsin-guanylyl cyclase of the aquatic fungus Blastocladiella emersonii enables fast optical control of cGMP signalingDepositorInsertshbeRhGC
red fluorescent protein
UseAAVExpressionMammalianPromoterhuman SynapsinAvailable SinceOct. 16, 2015AvailabilityAcademic Institutions and Nonprofits only