We narrowed to 9,450 results for: tre promoter
-
Plasmid#120514PurposeBarcoded lentiviral vector to express MYC Ser62Ala in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorInsertMYC Ser62Ala (MYC Human)
UseLentiviralMutationPoint mutation changing Serine to Alanine at amin…PromoterEF1aAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV ShadowG-AURKA-mTurq2
Plasmid#157768PurposeExpression of AuroraA kinase biosensor under CMV promoterDepositorAvailable SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-ZNF207-3xFLAG
Plasmid#231929PurposeVector for generating Flp-In cell lines allowing dox-inducible mammalian expression of ZNF207-3xFLAGDepositorAvailable SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pL(EF1a-phi-AQP1-FKBP12DD-IRES-EGFP-WPRE)
Plasmid#236279PurposeLentiviral vector that can express hAqp1 with fkbp12 degron in mammalian cells. EF1a promoter. EGFP marker.DepositorInserthuman aquaporin 1 (AQP1 Human)
UseLentiviralTagsFlag and fkbp12ExpressionMammalianPromoterEF1aAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pL(CMVtight-phi-AQP1-FKBP12DD-IRES-EGFP-WPRE)
Plasmid#236278PurposeLentiviral vector that can express doxycycline-inducible hAqp1 with fkbp12 degron in Tet ON mammalian cells. CMVtight promoter. EGFP marker.DepositorInserthuman aquaporin 1 (AQP1 Human)
UseLentiviralTagsFlag and fkbp12ExpressionMammalianPromoterCMVtightAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GFP-IRES-hSNCA (A11P/V70P)
Plasmid#185717PurposeAAV expression of GFP and human α-Synuclein with A11P and V70P mutations from hSyn promoterDepositorInsertsynuclein, alpha (SNCA Human)
UseAAVMutationChanged Ala 11 to Pro, Val 70 to ProPromoterhSynAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV ShadowY-AURKA-mTurq2
Plasmid#157770PurposeExpression of AuroraA kinase biosensor under CMV promoterDepositorAvailable SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPN432
Plasmid#137870PurposeExpression of gRNA a3 targeting TCF4 for CRISPRa; U6 promoterDepositorAvailable SinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPN431
Plasmid#137869PurposeExpression of gRNA a2 targeting TCF4 for CRISPRa; U6 promoterDepositorAvailable SinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPN435
Plasmid#137867PurposeExpression of gRNA i3 targeting TCF4 for CRISPRi; U6 promoterDepositorAvailable SinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPN434
Plasmid#137866PurposeExpression of gRNA i2 targeting TCF4 for CRISPRi; U6 promoterDepositorAvailable SinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPN446
Plasmid#137868PurposeExpression of gRNA a1 targeting TCF4 for CRISPRa; U6 promoterDepositorAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPN454
Plasmid#137865PurposeExpression of gRNA i1 targeting TCF4 for CRISPRi; U6 promoterDepositorAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
EF1a_MYC Glu39Ala_P2A_Hygro_Barcode
Plasmid#120512PurposeBarcoded lentiviral vector to express MYC Glu39Ala in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorInsertMYC Glu39Ala (MYC Human)
UseLentiviralMutationPoint mutation changing Glutamic Acid to Alanine …PromoterEF1aAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLentiCMV Puro DEST p38KTRmCerulean3
Plasmid#59155PurposeLentiviral vector to express p38 KTR mCerulean3 under CMV promoter (With Puromycin Resistance)DepositorInsertp38 Kinase Translocation Reporter (MAPK14 Mouse, Human)
UseLentiviralTagsmCerulean3ExpressionMammalianPromoterCMVAvailable SinceSept. 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SynI-CreOn-FlpOff-Kir2.1-P2A-EGFP
Plasmid#176278PurposeViral vector for co-expression of Kir2.1 and EGFP in cells expressing Cre AND NOT Flp driven by the human Synapsin promoter.DepositorInsertKir2.1-P2A-EGFP (Kcnj2 Synthetic, Mouse)
UseAAV and Cre/LoxTagsMycExpressionMammalianPromoterhuman Synapsin IAvailable SinceJan. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
MLM3636-Prnp-CDS-Pos
Plasmid#61857PurposeExpresses a gRNA plasmid targeting the prion gene's exon 3, positive strandDepositorAvailable SinceFeb. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
MLM3636-Prnp-CDS-Neg
Plasmid#61856PurposeExpresses a gRNA plasmid targeting the prion gene's exon 3, negative strandDepositorAvailable SinceFeb. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
BDS-2 3x WT (p53 binding site)
Plasmid#16515DepositorAvailable SinceOct. 6, 2008AvailabilityAcademic Institutions and Nonprofits only -
-
pLV-ATF5-PROX1-HNF1A
Plasmid#149725Purposeexpressing three liver promoting transcription factors (ATF5, PROX1, HNF1A)DepositorAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
p420-3
Plasmid#71257Purposeluciferase reporter with 3 copies of the GM420 NFAT-AP-1 site in front of hGM-CSF -55 to +28 minimal promoterDepositorInsert3 copies of the GM420 NFAT-AP-1 site (CSF2 Human)
UseLuciferaseTagsluciferaseExpressionMammalianPromoterGM-CSF minimalAvailable SinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT TO Myc ArC Long WT
Plasmid#59809PurposeAllows the integration of Myc ArC Long in the genome and Tet-inducible expression.DepositorInsertAurora C (AURKC Human)
TagsMycExpressionMammalianPromoterhybrid human cytomegalovirus (CMV)/TetO2 promoterAvailable SinceFeb. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT TO Myc ArC K72R
Plasmid#59811PurposeAllows the integration of Myc ArC K72R in the genome and Tet-inducible expression.DepositorInsertAurora C (AURKC Human)
TagsMycExpressionMammalianMutationK72R, kinase mutantPromoterhybrid human cytomegalovirus (CMV)/TetO2 promoterAvailable SinceFeb. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST17-Ctdnep1_C-ter
Plasmid#196525PurposeExpression of Ctdnep1_C-terDepositorInsertCtdnep1-C-ter (CTDNEP1 Human)
TagsHisExpressionBacterialMutationNo transmembrane domainPromoterT7 promoterAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
ET8-GPIba-6His
Plasmid#102878PurposeWild type human platelet membrane protein GPIb alpha (1-290aa) with 6Histag at the C-terminusDepositorInsertHuman platelet membrane protein GPIb alpha 1-290aa (GP1BA Human)
Tags6xHis tagExpressionMammalianPromoterCMV promoterAvailable SinceNov. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
EF1a_POU5F1_P2A_Hygro_Barcode
Plasmid#120474PurposeBarcoded lentiviral vector to express POU5F1 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-PDL1
Plasmid#159280PurposeHuman AAVS1 targeting vector for knockin of a CAGGS promoter-driven human PDL1/CD274 (cloned between AgeI and PacI). Targeted cells will be puromycin resistant.DepositorInsertHuman PDL1/CD274 (CD274 Human)
UseAAV; S1 knockin donor vectorExpressionMammalianPromoterCAGGSAvailable SinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSG5-hEKLF
Plasmid#67835PurposeExpression of human EKLF driven by SV40 promoter for use in activation studiesDepositorAvailable SinceAug. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS_HA-VP35_EBOV
Plasmid#103053PurposeMammalian expression vector encoding HA-tagged Ebola virus VP35 gene under control of the CAG promoterDepositorAvailable SinceDec. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
EF1a_GATA1_P2A_Hygro_Barcode
Plasmid#120442PurposeBarcoded lentiviral vector to express GATA1 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceFeb. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT TO Myc ArB WT RNAiR
Plasmid#59806PurposeAllows the integration of Myc ArB in the genome and Tet-inducible expression.DepositorInsertAurora B (AURKB Human)
TagsMycExpressionMammalianMutationRNAi resistantPromoterhybrid human cytomegalovirus (CMV)/TetO2 promoterAvailable SinceFeb. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSG5-FLAG-mEKLF
Plasmid#67833PurposeExpression of FL-EKLF driven by SV40 promoterDepositorInsertEKLF (Klf1 Mouse)
TagsFLAGExpressionMammalianMutationFull-length mEKLF is aa 20-376; amino acid 19 is …PromoterSV40Available SinceAug. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
LV_EF1a_Caspase8(C360A)-P2A-Hygro_Barcode
Plasmid#170217PurposeBarcoded lentiviral vector to express Caspase8 (C360A) in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seqDepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 TO FRT Myc ArB K106R
Plasmid#59807PurposeAllows the integration of Myc ArB K106R in the genome and Tet-inducible expressionDepositorInsertAurora B (AURKB Human)
TagsMycExpressionMammalianMutationK106R, kinase mutantPromoterhybrid human cytomegalovirus (CMV)/TetO2 promoterAvailable SinceFeb. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCAG1.1-Armc12/FLAG
Plasmid#180494PurposeExpression vector of mouse armadillo repeat containing 12 (Armc12) tagged with FLAG at C-terminus. See Fig.4D of Shimada, K. et al. Proc. Natl. Acad. Sci. USA. 118 (6): e2018355118, 2021.DepositorInsertarmadillo repeat containing 12 (Armc12 Mouse)
TagsFLAG tagExpressionMammalianPromoterCAG promoterAvailable SinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
BDS-2 3x MUT (p53 binding site)
Plasmid#16516DepositorInsertp53 binding site (SFN Human)
TagsLuciferaseExpressionMammalianMutationMutant p53 binding sitesAvailable SinceMarch 28, 2008AvailabilityAcademic Institutions and Nonprofits only -
pBEL1200
Plasmid#138526PurposeFor expresson of mlaFEDCB operon from E. coli. N-terminal his tag on MlaD, araBAD promoter.DepositorTagsN-terminal His tag and TEV cleavage site on MlaDExpressionBacterialPromoteraraBADAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
3xAP1pGL3 (3xAP-1 in pGL3-basic)
Plasmid#40342DepositorInsert3xAP-1
UseLuciferaseTagsLuciferaseExpressionMammalianMutationContains three canonical AP-1 binding sites (TGAC…Available SinceSept. 28, 2012AvailabilityAcademic Institutions and Nonprofits only