We narrowed to 28,582 results for: RAN-1
-
Plasmid#206186Purposein vitro transcription of RNA encoding human ACVR1 with mutations T189V, S190A, and R206HDepositorInsertactivin A receptor type 1 (ACVR1 Human)
UseIn vitro transcriptionTagsFLAG tagMutationT189V, S190A, R206HAvailable SinceOct. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF2967
Plasmid#144443PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceSept. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF2826
Plasmid#143631PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF2824
Plasmid#143630PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
DNMT2Δ191-237
Plasmid#198382PurposeBacterial expression plasmid for human DNMT2 deletion mutant; for binding assaysDepositorInsertDNMT2 (TRDMT1 Human)
TagsHis-tagExpressionBacterialMutationdeleted amino acids 191-237PromoterT7Available SinceMay 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF2827
Plasmid#143632PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pB80-KIF1A(1-365)-GCN4-GFP-SSPB(micro)
Plasmid#174632PurposeHighly processive KIF1A for optogenetic heterodimerization to iLID via SSPB(micro)DepositorInsertKIF1A(1-365)-GCN4-GFP-SSPB(micro) (Kif1a Synthetic, Mouse)
TagsGFP-SSPB(micro)ExpressionMammalianMutationmmKIF1A(aa1-365): Pro202Ala; EGFP: Met1Del; SSPB:…PromoterChicken beta-actinAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR/D-Topo CDS A. thaliana IMPORTIN ALPHA 2
Plasmid#175816PurposepENTR plasmid with CDS of Arabidopsis thaliana IMPORTIN ALPHA ISOFORM 2 (AT4G16143.1) without stop codon for C-terminal epitope tagsDepositorInsertIMPORTIN ALPHA ISOFORM 2 (IMPA-2 Mustard Weed)
UsePentr plasmid for gateway cloningTagsnoneMutationnatural polymorphism P65S, annotated in Genbank f…PromoternoneAvailable SinceOct. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCFJ1972 - [1-2] ENTR - Flour - TagBFP2(NLS(2), no_atg, no_stop)
Plasmid#159844PurposeThree-fragment Gateway compatible flourophore for expression in C. elegansDepositorInsert[1-2] ENTR - Flour - TagBFP2(NLS(2), no_atg, no_stop)
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFd029.R2.RFP
Plasmid#137972PurposeExpresses Prochlorococcus marinus NATL1A Fd 1 fused to mRFPDepositorInsertProchlorococcus marinus NATL1A ferredoxin 1 fused to monomeric RFP
UseSynthetic BiologyAvailable SinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFd030.R2.RFP
Plasmid#137973PurposeExpresses Prochlorococcus marinus NATL2A Fd 1 fused to mRFPDepositorInsertProchlorococcus marinus NATL2A ferredoxin 1 fused to monomeric RFP
UseSynthetic BiologyAvailable SinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFd031.RFP
Plasmid#137974PurposeExpresses Prochlorococcus marinus MIT9211 Fd 1 fused to mRFPDepositorInsertProchlorococcus marinus MIT9211 ferredoxin 1 fused to monomeric RFP
UseSynthetic BiologyAvailable SinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPRIME-CMV-GFP-shNts1
Plasmid#132713PurposeEncodes short hairpin RNA (shRNA) #1 that targets the the 3’-untranslated region of the rat Nts geneDepositorAvailable SinceOct. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
-
AtPIN2
Plasmid#117089Purposeprotein expression in yeastDepositorInsertAtPIN2
TagsHisExpressionYeastPromoterAOXAvailable SinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
tdTomato-Cx32-7
Plasmid#58085PurposeLocalization: Gap Junctions, Excitation: 554, Emission: 581DepositorAvailable SinceDec. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
mKO-Cx32-7
Plasmid#57835PurposeLocalization: Gap Junctions, Excitation: 548, Emission: 561DepositorAvailable SinceOct. 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
mKO2-Cx32-7
Plasmid#57866PurposeLocalization: Gap Junctions, Excitation: 551, Emission: 565DepositorAvailable SinceOct. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
mKOet-Cx32-7
Plasmid#57915PurposeLocalization: Gap Junctions, Excitation: 548, Emission: 561DepositorAvailable SinceOct. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
Rabbit NHERF-1
Plasmid#31644DepositorInsertsolute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 1 (SLC9A3R1 Rabbit)
ExpressionBacterialMutationnoneAvailable SinceFeb. 14, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAc-GFP-dSUMO
Plasmid#85696Purposeexpression of GFP-SUMO1 in Drosophila cellsDepositorAvailable SinceMarch 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
mCherry-FKBP-SAC1-HLx10
Plasmid#108137PurposeRecruitable SAC1 with extended linkerDepositorInsertmCherry:FKBP1A(3-108):[GGSA]4GG:SACM1L(1-520):[EAAAR]10:SACM1L(521-587) (SACM1L Human)
ExpressionMammalianMutationSACM1L(1-520):[EAAAR]10:SACM1L(521-587)PromoterCMVAvailable SinceApril 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pVENUS-N1-FNTA
Plasmid#86859PurposeTo express FNTA with a Venus tag at C terminus.DepositorInsertFNTA (FNTA Human)
TagsVenusExpressionMammalianMutationThe sequence of the insert is isoform 2, which di…PromoterCMVAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTH371-SUP45-N58A
Plasmid#29378DepositorInsertSUP45 gene encoding translation release factor 1 from S. cerevisiae (SUP45 Budding Yeast)
ExpressionYeastMutationN58A mutant gene including genomic sequence 1432 …Available SinceMay 23, 2011AvailabilityAcademic Institutions and Nonprofits only -
pTH397-SUP45-I222S
Plasmid#29388DepositorInsertSUP45 gene encoding translation release factor 1 from S. cerevisiae (SUP45 Budding Yeast)
ExpressionYeastMutationI222S mutant gene (corresponding to the sup45-2 a…Available SinceMay 23, 2011AvailabilityAcademic Institutions and Nonprofits only -
426Gal-FUS-1-170aa-YFP
Plasmid#29596DepositorAvailable SinceApril 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
426Gal-FUS-1-453aa-YFP
Plasmid#29600DepositorAvailable SinceApril 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pFU-iMVIIA-PE
Plasmid#24146DepositorInsertomega-Conotoxin MVIIA-FLAG-PDGF_R_TM-EGFP-IRES-TetR-KRAB (PDGFRB Conus magus, Aequorea victoria, Human)
UseLentiviralExpressionMammalianAvailable SinceApril 28, 2010AvailabilityAcademic Institutions and Nonprofits only -
pB-TR-hSOD1
Plasmid#232478PurposeTetracycline inducible PiggyBac vector expressing human SOD1gene including flag-tag (DYKDDDDK) on the 3' endDepositorInsertHomo sapiens superoxide dismutase 1 (SOD1 Human)
UseTransposon systemTagsDYKDDDDK (FLAG-tag)ExpressionMammalianPromoterCMV-TetOAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
siRNA-resistant ss-SigmaR1DTM-mNeonGreen R119A F191A
Plasmid#226576PurposeEncodes mutant siRNA resistant SigmaR1 protein (transmembrane region deletion + substitutions) labeled with mNeonGreenDepositorInsertSigmaR1 (Sigma-1 Receptor) (SIGMAR1 Human)
TagsmNeonGreenExpressionMammalianMutationR119A, F191AAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
siRNA-resistant SigmaR1-mNeonGreen a4mut (I178A L182A L186A V190A)
Plasmid#226577PurposeEncodes mutant siRNA resistant SigmaR1 protein (substitutions) labeled with mNeonGreenDepositorInsertSigmaR1 (Sigma-1 Receptor) (SIGMAR1 Human)
TagsmNeonGreenExpressionMammalianMutationI178A, L182A, L186A, V190AAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
siRNA-resistant SigmaR1-mNeonGreen a5mut (F196A L199A F200A L203A Y206A L210A L214A Y217A)
Plasmid#226578PurposeEncodes mutant siRNA resistant SigmaR1 protein (substitutions) labeled with mNeonGreenDepositorInsertSigmaR1 (Sigma-1 Receptor) (SIGMAR1 Human)
TagsmNeonGreenExpressionMammalianMutationF196A, L199A, F200A, L203A, Y206A, L210A, L214A, …Available SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
ss-SigmaR1DTM-mNeonGreen
Plasmid#226575PurposeEncodes mutant SigmaR1 protein (transmembrane region deletion) labeled with mNeonGreenDepositorAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
TFORF1842
Plasmid#143324PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIS-MDH1-HIS
Plasmid#184558PurposeBacterial expression of human MDH1 with HIS TagDepositorAvailable SinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
PGK EGFP-LC3B
Plasmid#200427PurposeMammalian expression of fluorescently-tagged marker for autophagic vesiclesDepositorAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFOSGE_COF2G08
Plasmid#70915PurposeGateway entry cloneDepositorInsertParg (Parg Fly)
UseGateway CloningAvailable SinceNov. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
p173 Dync1i2.A (Ex1b)
Plasmid#26443DepositorInsertcytoplasmic dynein 1 intermediate chain 2 isoform A (exon 1b) (Dync1i2 Mouse)
UseSubcloning and sequencingMutationN/AAvailable SinceMarch 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
p196 Dync1i2.A (Ex 1a)
Plasmid#26446DepositorInsertcytoplasmic dynein 1 intermediate chain 2 isoform A (exon 1a) (Dync1i2 Mouse)
UseSubcloning and sequencingMutationN/AAvailable SinceMarch 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
TFORF0612
Plasmid#143054PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin I no force control (F40-based)
Plasmid#119187PurposeThe no force control for the F40-based human desmoplakin I tension sensor serves to detect changes in FRET between mTFP1 and mEYFP that are tension-independent.DepositorInserthuman Desmoplakinhuman Desmoplakin I (1-1945)-[mTFP1-F40-mEYFP] (DSP Human)
UseTransposonTagsmTFP1-F40-mEYFPExpressionMammalianMutationtruncation after aa1945PromoterTCEAvailable SinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
p2xFLAGhYAP2-WW1-mutant
Plasmid#17795DepositorInsertYes-kinase associated protein (YAP1 Human)
Tags2xFlagExpressionMammalianMutationTryptophan 199 to Alanine; Proline 202 to AlanineAvailable SinceMay 9, 2008AvailabilityAcademic Institutions and Nonprofits only -
p2xFLAGhYAP2-WW2-mutant
Plasmid#17796DepositorInsertYes-kinase associated protein (YAP1 Human)
Tags2xFlagExpressionMammalianMutationTryptophan 258 to Alanine Proline 261 to AlanineAvailable SinceMay 9, 2008AvailabilityAcademic Institutions and Nonprofits only -
pCS5-3HA/p14ARF
Plasmid#78764PurposeTo overexpress p14ARF in Mammalian CellsDepositorAvailable SinceJune 9, 2016AvailabilityAcademic Institutions and Nonprofits only