We narrowed to 1,648 results for: CAG promoter
-
Plasmid#160213PurposeKnock Down MYDSH3- Collybistin isoforms, 3-point mutation negative control for CBSH3- shRNA3 targeting collybistin MYD-CBSH3- isoforms (Plasmid #160212)DepositorInsertARHGEF9 (Arhgef9 Rat)
UseRNAiMutationTGTATGACCTCaGGcTGtACCA (mutations shown in lower …Promotermouse U6 promoterAvailable SinceOct. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
CBSH3- 3m shRNA2
Plasmid#160211PurposeKnock Down MTLSH3- Collybistin isoforms, 3-point mutation negative control for CBSH3- shRNA2 targeting collybistin MTL-CBSH3-isoforms (Plasmid #160210)DepositorInsertARHGEF9 (Arhgef9 Rat)
UseRNAiMutationTGACGTTGCTCaGGcTGtACCA (mutations shown in lower …Promotermouse U6 promoterAvailable SinceOct. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
CBSH3- 3m shRNA1
Plasmid#160209PurposeKnock Down MQWSH3- Collybistin isoforms, 3-point mutation negative control for CBSH3- shRNA1 targeting collybistin MQW-CBSH3- isoforms (Plasmid # 160208).DepositorInsertARHGEF9 (Arhgef9 Rat)
UseRNAiMutationGATCGGGAATGCTCaGGcTGtACC (mutations shown in lowe…Promotermouse U6 promoterAvailable SinceOct. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCIS.MTRIA-C3a
Plasmid#184601PurposeFor expression of a fluorescent sensor for C3a complement in mammalian cellsDepositorInsertMTRIA-C3a
ExpressionMammalianPromoterCAG promoterAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCIS.MTRIA-ENK
Plasmid#184604PurposeFor expression of a fluorescent sensor for enkephalin in mammalian cellsDepositorInsertMTRIA-ENK
ExpressionMammalianPromoterCAG promoterAvailable SinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCIS.MTRIA-LTB
Plasmid#184605PurposeFor expression of a fluorescent sensor for leukotriene B4 in mammalian cellsDepositorInsertMTRIA-LTB
ExpressionMammalianPromoterCAG promoterAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCIS.MTRIA-AVP
Plasmid#184600PurposeFor expression of a fluorescent sensor for vasopressin in mammalian cellsDepositorInsertMTRIA-AVP
ExpressionMammalianPromoterCAG promoterAvailable SinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCIS.MTRIA-OT
Plasmid#184596PurposeFor expression of a fluorescent sensor for oxytocin in mammalian cellsDepositorInsertMTRIA-OT
ExpressionMammalianPromoterCAG promoterAvailable SinceJune 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCIS.MTRIA-NPFF
Plasmid#184612PurposeFor expression of a fluorescent sensor for neuropeptide FF in mammalian cellsDepositorInsertMTRIA-NPFF
ExpressionMammalianPromoterCAG promoterAvailable SinceJune 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCIS.MTRIA-PGE
Plasmid#184617PurposeFor expression of a fluorescent sensor for prostaglandin E2 factor in mammalian cellsDepositorInsertMTRIA-PGE
ExpressionMammalianPromoterCAG promoterAvailable SinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCIS.MTRIA-NE
Plasmid#184608PurposeFor expression of a fluorescent sensor for norepinephrine in mammalian cellsDepositorInsertMTRIA-NE
ExpressionMammalianPromoterCAG promoterAvailable SinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTalpha1-Dre
Plasmid#133925PurposeNeuron-specific expression of DreDepositorInsertHA-Dre
TagsHAExpressionMammalianPromoterCAG promoterAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCIS.MTRIA-MTN
Plasmid#184607PurposeFor expression of a fluorescent sensor for melatonin in mammalian cellsDepositorInsertMTRIA-MTN
ExpressionMammalianPromoterCAG promoterAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCIS.MTRIA-ATP
Plasmid#184599PurposeFor expression of a fluorescent sensor for ATP in mammalian cellsDepositorInsertMTRIA-ATP
ExpressionMammalianPromoterCAG promoterAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBT224_(pCA-tTA2)
Plasmid#36430DepositorInserttetracycline transactivator
ExpressionMammalianPromoterCAG (chicken beta actin promoter and CMV enhancer)Available SinceJune 25, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCIS.MTRIA-NKB
Plasmid#184609PurposeFor expression of a fluorescent sensor for neurokinin B in mammalian cellsDepositorInsertMTRIA-NKB
ExpressionMammalianPromoterCAG promoterAvailable SinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCIS.MTRIA-MCH
Plasmid#184606PurposeFor expression of a fluorescent sensor for melanin-concentrating hormone in mammalian cellsDepositorInsertMTRIA-MCH
ExpressionMammalianPromoterCAG promoterAvailable SinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCIS.MTRIA-DA
Plasmid#184603PurposeFor expression of a fluorescent sensor for dopamine in mammalian cellsDepositorInsertMTRIA-DA
ExpressionMammalianPromoterCAG promoterAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCIS.MTRIA-5HT
Plasmid#184597PurposeFor expression of a fluorescent sensor for serotonin in mammalian cellsDepositorInsertMTRIA-5HT
ExpressionMammalianPromoterCAG promoterAvailable SinceJune 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCIS.MTRIA-NPY
Plasmid#184613PurposeFor expression of a fluorescent sensor for neuropeptide Y in mammalian cellsDepositorInsertMTRIA-NPY
ExpressionMammalianPromoterCAG promoterAvailable SinceJune 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCIS.MTRIA-SST
Plasmid#184619PurposeFor expression of a fluorescent sensor for somatostatin in mammalian cellsDepositorInsertMTRIA-SST
ExpressionMammalianPromoterCAG promoterAvailable SinceJune 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCIS.MTRIA-OX
Plasmid#184615PurposeFor expression of a fluorescent sensor for orexin in mammalian cellsDepositorInsertMTRIA-OX
ExpressionMammalianPromoterCAG promoterAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCIS.MTRIA-AGT
Plasmid#184598PurposeFor expression of a fluorescent sensor for angiotensin II in mammalian cellsDepositorInsertMTRIA-AGT
ExpressionMammalianPromoterCAG promoterAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCIS.MTRIA-CCK
Plasmid#184602PurposeFor expression of a fluorescent sensor for CCK in mammalian cellsDepositorInsertMTRIA-CCK
ExpressionMammalianPromoterCAG promoterAvailable SinceJune 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCIS.MTRIA-PRLH
Plasmid#184618PurposeFor expression of a fluorescent sensor for Prolactin-releasing peptide factor in mammalian cellsDepositorInsertMTRIA-PRLH
ExpressionMammalianPromoterCAG promoterAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCIS.MTRIA-NOC
Plasmid#184611PurposeFor expression of a fluorescent sensor for nociceptin in mammalian cellsDepositorInsertMTRIA-NOC
ExpressionMammalianPromoterCAG promoterAvailable SinceJune 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBpuro-RasS17N
Plasmid#214820PurposeEncoding dominant negative HRasDepositorInsertDominant negative HRas
ExpressionMammalianPromoterCAG promoterAvailable SinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPBpuro-Rac1T17N
Plasmid#214821PurposeEncoding dominant negative Rac1DepositorInsertDominant negative Rac1
ExpressionMammalianPromoterCAG promoterAvailable SinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPBpuro-Rab5S34N
Plasmid#214822PurposeEncoding dominant negative Rab5ADepositorInsertDominant negative Rab5
ExpressionMammalianPromoterCAG promoterAvailable SinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCIS.MTRIA-PAF
Plasmid#184616PurposeFor expression of a fluorescent sensor for platelet-activating factor in mammalian cellsDepositorInsertMTRIA-PAF
ExpressionMammalianPromoterCAG promoterAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCIS.MTRIA-UTS
Plasmid#184620PurposeFor expression of a fluorescent sensor for urotensin II in mammalian cellsDepositorInsertMTRIA-UTS
ExpressionMammalianPromoterCAG promoterAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCIS.MTRIA-NTS
Plasmid#184614PurposeFor expression of a fluorescent sensor for neurotensin in mammalian cellsDepositorInsertMTRIA-NTS
ExpressionMammalianPromoterCAG promoterAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCIS.MTRIA-NMB
Plasmid#184610PurposeFor expression of a fluorescent sensor for neuromedin B in mammalian cellsDepositorInsertMTRIA-NMB
ExpressionMammalianPromoterCAG promoterAvailable SinceJune 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHIE043 ZF43x1 mKate2 (TUPV1)
Plasmid#138723PurposemMoClo TUPV, with ZF43x1 promoter and mKate2 in the MCSDepositorInsertZF43x1
UseSynthetic BiologyExpressionMammalianPromoterZF43x1Available SinceNov. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHIE042 ZF43x0 mKate2 (TUPV1)
Plasmid#138722PurposemMoClo TUPV, with ZF43x0 promoter and mKate2 in the MCSDepositorInsertZF43x0
UseSynthetic BiologyExpressionMammalianPromoterZF43x0Available SinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-puro_TRE3VG_EGFP-Responder
Plasmid#230050PurposeIt presents the TRE3VG inducible promoter allowing the dox-dependent inducible activation of EGFP through the OPTi-OX platformDepositorInsertTRE3VG_EGFP
ExpressionMammalianPromoterGAAGACAATAGCAGGCATGAvailable SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pmEmerald_mEmerald_I3
Plasmid#231681PurposeExpresses the I3-01 nanocage subunit N-terminally tagged with two tandem mEmeralds in mammalian cells. Assembles into nanocages tagged with 120 mEmerald FPs.DepositorInsertI3-01
TagsmEmeraldExpressionMammalianMutationK129APromoterCMVAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pmEmerald_I3
Plasmid#231680PurposeExpresses the I3-01 nanocage subunit N-terminally tagged with one mEmerald in mammalian cells. Assembles into nanocages tagged with 60 mEmerald FPs.DepositorInsertI3-01
TagsmEmeraldExpressionMammalianMutationK129APromoterCMVAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGG184
Plasmid#165604PurposeReporter plasmid for B1H-dependent expression of the HIS3/GFP operon with a single hEGFP protospacer: PS1(upstream of promoter with 'CAGCG' PAM)-lac-HIS3 and GFPDepositorInserthEGFP protospacer ('CAGCG' PAM) upstream of the HIS3/GFP promoter
UseSynthetic BiologyExpressionBacterialMutation'CAGCG' PAM replacing the 'CGGCG…PromoterlacAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pstb-LAFR5
Plasmid#86169PurposepLAFR5 with Smb21651 promoter. pLAFR5 is a broad-host range cosmid vector with double cos sites.DepositorTypeEmpty backboneExpressionBacterialPromoterSMb21651 promoterAvailable SinceFeb. 6, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
CMV:AsCpf1-2A-GFP-U6-GFP-sg
Plasmid#194717PurposeBicistronic vector expressing CMV promoter driven AsCpf1, and U6 promoter driven guide RNA that target GFPDepositorInsertAsCpf1
UseCRISPRExpressionMammalianAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
p304N
Plasmid#246317PurposePlant CRISPR editing with the experimentally validated Medicago truncatula MtU6.6 promoter (352 bp)DepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCLYBL-Neo_TRE3VG_mCherry_Responder
Plasmid#230054PurposeIt presents the TRE3VG inducible promoter allowing the dox-dependent inducible activation of mCherry through the OPTi-OX platform. The CLYBL GSH supports higher transgene expressionDepositorInsertTRE3VG_mCherry
ExpressionMammalianPromoterTRE3VGAvailable SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G8_MTOR_Nick_Intron-45_Dual_sgRNA
Plasmid#178106PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G8 and MTOR Nick intron-45 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G8 + MTOR nick intron-45 sgRNAs
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCK389
Plasmid#206791PurposeSp.dCas9, pTet.MCP-SoxS, J23119.gRNADepositorInsertsdCas9
MCP-SoxS
scRNA
PromoterJ23119 and TetAvailable SinceSept. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
3xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2 probasin_mTQ2_FlpO
Plasmid#68405PurposeThe prostate specific promoter controls expression of FlpO linked to a blue flourescent protein. gRNA towards PTEN ex5, p53 ex8 and SMAD4 ex2. are expressed by the U6 promoterDepositorInserts3xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2
FlpO
UseCRISPRTagsmTurquoise2 (BFP)ExpressionMammalianPromoterSynthetic Probasin ARRx2 and U6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSP571
Plasmid#139498PurposeCRISPR-Cas9 plasmid to generate double strand break in STL1 locus in S. cerevisiae. Expresses both Cas9 and STL1 sgRNADepositorInsertpGPD Cas9 / sgRNA (STL162)
ExpressionYeastMutationWTPromoterpGPDAvailable SinceJune 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_RRT8
Plasmid#166080PurposePlasmid for constituive spCas9 expression and tet-inducible expression of sgRNA binding to the promoter of RRT8 for double stranded break formation in yeast.DepositorAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only