We narrowed to 16,060 results for: grna
-
Pooled Library#1000000078PurposeGenome-wide CRISPR gRNA pooled library for activation of human genesDepositorAvailable SinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits only
-
M-ST1-sgRNA
Plasmid#48672PurposeMammalian U6-driven sgRNA (STm1) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. thermophilus #1 Cas9, hU6 promoter
UseCRISPRPromoterhUAvailable SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pTE4396
Plasmid#74041PurposeExpresses human codon-optimized AsCpf1 and As crRNA.DepositorInsertsAs crRNA
AsCpf1
UseCRISPRTags3xHA and NLSExpressionMammalianPromoterCMV and human U6Available SinceApril 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX330 Pten
Plasmid#59909PurposepX330 backbone expressing sgRNA targeting Pten to edit mouse Pten. Expresses Cas9 from CBh promoterDepositorAvailable SinceMarch 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHSN501
Plasmid#50589PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses zCas9D10A, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInsertszCas9D10A
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG and NLSMutationCas9D10A nickase, was derived from the zCas9 and …Promoter2×35Sp and AtU6-26pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-E
Plasmid#78852PurposeIntroduce sgRNA into a lentiviral vector (LentiCRISPR V2) which contains eSpCas9 and puromycin cassetteDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsCas9-P2A-PuroExpressionMammalianAvailable SinceJune 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
CMVp-dsRed2-Triplex-HHRibo-gRNA1-HDVRibo-pA
Plasmid#55201PurposePlasmid encoding the Ribozyme/gRNA architecture. This is a modified form of the original plasmid described in the paper (Construct 13). mKate2 was replaced with dsRed2 because of distribution issues.DepositorInsertdsRed2
UseSynthetic BiologyExpressionMammalianPromoterCMVAvailable SinceJune 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pX330-U6-Chimeric_BB-CBh-hSpCas9-hGem(1/110)
Plasmid#71707PurposeA human codon-optimized SpCas9 fused to first 110 amino acids of human GEMININ and chimeric guide RNA expression plasmidDepositorInserthumanized S. pyogenes Cas9 fused to human Geminin (GMNN Human)
UseCRISPRTags3xFLAG and hGEM(1/110)ExpressionMammalianPromoterCBhAvailable SinceFeb. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pL-CRISPR.SFFV.GFP
Plasmid#57827PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA. Coexpresses eGFP via P2A cleavage site. SFFV Promoter drivenDepositorInsertsSpCas9
Sp sgRNA scaffold
SFFV
P2A-eGFP
UseCRISPR and LentiviralTagsFLAGAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
lentiSAM v2 (Puro)
Plasmid#92062PurposeModified version of lentiSAM v2, a lenti sgRNA cloning backbone with MS2 loops at tetraloop/stemloop 2, dCas9-VP64, and puro resistance marker. Contains BsmBI sites for insertion of spacer sequences.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 (sgRNA) and EF1a (dCas9-VP64)Available SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2 puro
Plasmid#98290PurposeVariant of lentiCRISPRv2 that confers puromycin resistanceDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPR and LentiviralPromoterEF-1aAvailable SinceJuly 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide Puro-P2A-EGFP
Plasmid#137729PurposeFor simple determination of the multiplicity of infection (MOI) of a lentiviral CRISPR library by checking EGFP expression (still allowing for puro selection).DepositorTypeEmpty backboneUseCRISPR, Lentiviral, and Synthetic BiologyTagsEGFPExpressionBacterial and MammalianAvailable SinceFeb. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1661-sgMUC4-E3(F+E)
Plasmid#51025PurposeLentiviral vector that contains an optimized S. pyogenes sgRNA targeting the repetitive sequence of human MUC4 exon 3DepositorInsertoptimized sgRNA (MUC4 Human, Mouse)
UseCRISPR and LentiviralExpressionMammalianPromotermouse U6Available SinceFeb. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
Mouse genome-wide lentiviral CRISPR gRNA library version 2
Pooled Library#67988PurposeKnockout library targeting 18,424 mouse genes. gRNAs were improved using a new design pipeline and improved gRNA scaffold.DepositorSpeciesHomo sapiens, Mus musculus, and SyntheticUseCRISPR and LentiviralAvailable SinceOct. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTE4398
Plasmid#74042PurposeExpresses human codon-optimized LbCpf1 and Lb crRNA.DepositorInsertsLb crRNA
LbCpf1
UseCRISPRTags3xHA and NLSExpressionMammalianPromoterCMV and human U6Available SinceApril 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSL1142 (pSPIN, pBBR1 backbone)
Plasmid#160730PurposeSingle-plasmid V. cholerae CAST system, encodes all proteins, crRNA, and donor DNA. Entry vector encodes non-targeting crRNA, with BsaI sites for spacer cloning. pBBR1 backbone.DepositorInsertVchCAST proteins, crRNA, and donor DNA
ExpressionBacterialPromoterJ23119Available SinceDec. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-SpCas9-NG
Plasmid#117919PurposeExpresses 3xFLAG-NLS-SpCas9-NG-NLS in mammalian cells.DepositorInsertSpCas9-NG (L1111R/D1135V/G1218R/E1219F/A1322R/R1335V/T1337R)
ExpressionMammalianAvailable SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgGFP-NT1
Plasmid#46914PurposeHuman pSico-based U6 vector containing murine U6 promoter and sgRNA targeting GFP (NT1)DepositorInsertsgGFP-NT1
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceOct. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
Human genome-wide lentiviral CRISPR gRNA library version 1
Pooled Library#67989PurposeKnockout library targeting 18,010 human genes. gRNAs were improved using a new design pipeline and improved gRNA scaffold.DepositorSpeciesHomo sapiens, Mus musculus, and SyntheticUseCRISPR and LentiviralAvailable SinceOct. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-miRFP670
Plasmid#91854PurposeCas9 from S. pyogenes with 2A-miRFP670, and cloning backbone for sgRNA. Modified Zhang Plasmid #62988DepositorInsertshSpCas9-2A-miRFP670
BB-guide RNA
UseCRISPRTags2A-miRFP670 and 3XFLAGExpressionMammalianPromoterCbh and U6Available SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only