We narrowed to 15,163 results for: GRN
-
Plasmid#17316DepositorAvailable SinceFeb. 20, 2008AvailabilityAcademic Institutions and Nonprofits only
-
pD649-HAsp-FCGRT-COMP5AP-AviTag-9xHis
Plasmid#157384PurposeMammalian expression of cell-surface protein extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgSMARCA4 guide 2
Plasmid#193605PurposeSMARCA4 knockoutDepositorInsertsgSMARCA4 guide 2 (SMARCA4 Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
HP-Cas9hGem-Ade2-LEU2-LINEAR
Plasmid#174839PurposepRS414 backbone containing LINEAR fragment targeting ADE2 in H. polymorphaDepositorInsertHH-gRNA-HDV targetting ADE2 in Ogataea (para)polymorpha
UseCRISPR and Synthetic BiologyExpressionBacterial and YeastPromoterTDH3pAvailable SinceJan. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast HA-GPAT4
Plasmid#173168PurposeRetroviral vector to express sgRNA resistant HA tagged human GPAT4DepositorInsertGlycerol-3-Phosphate Acyltransferase 4 (GPAT4 Human)
UseRetroviralTagsHAMutationSynonymous mutations at sgRNA sitesPromoterMMLVAvailable SinceAug. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr2-Gnaq
Plasmid#170298PurposeEncoding mouse GnaqDepositorInsertA recombinant mouse Gnaq (Gnaq Mouse)
TagsN/AExpressionMammalianMutationAsilent mutation was introduced into the sgRNA-ta…Available SinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
BII-gR-BtW-eSpCas9
Plasmid#133358PurposePiggybac vector for CRISPR/SpCas9 applications (nuclease, base editing, or epigenetic modifications). Provides gRNA and EspCas9 expressionDepositorInserteSpCas9
TagsFlag-tagged eSpCas9ExpressionMammalianMutationeSpCas9 mutationsPromoterCMV enhancer and hEf1a (CpG free)Available SinceJan. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
BII-gR-PtW-eSpCas9
Plasmid#133357PurposePiggybac vector for CRISPR/SpCas9 applications (nuclease, base editing, or epigenetic modifications). Provides gRNA and EspCas9 expressionDepositorInserteSpCas9
TagsHA-tagged eSpCas9ExpressionMammalianMutationeSpCas9 mutationsPromoterCMV enhancer and hEf1a (CpG free)Available SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO-PHB-8
Plasmid#122233PurposeExpresses shRNA targeting the coding sequence of human PHBDepositorInsertshRNA targeting PHB (see partial depositor seq) (PHB1 Human)
UseLentiviral and RNAiExpressionMammalianAvailable SinceAug. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
TRIN-shMYB.2652
Plasmid#105575PurposeDox-inducible mir30 MYB shRNA/dsRED expression with Venus marker and neo resistanceDepositorInsertMYB shRNA #2652
UseRNAi and RetroviralExpressionMammalianPromoterTREAvailable SinceMarch 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSUPER-retro-puro-Smad2
Plasmid#89827PurposeKnockdown human Smad2 expression in human mammalian cellsDepositorInsertSMAD2 shRNA (SMAD2 Human)
UseRetroviralAvailable SinceMay 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSIREN-RetroQ-BPTF-sh3
Plasmid#73667PurposepSIREN-RetroQ vector containing shRNA sequence to BPTFDepositorAvailable SinceMarch 22, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
PSUPER-1660(hPot1)
Plasmid#11131DepositorInsertRNAi against human Protection of Telomeres 1 (POT1 Human)
UseRNAiExpressionMammalianMutationN/AAvailable SinceMarch 3, 2006AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-Hyg-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196082Purpose(Empty Backbone) Inducible CRISPRi vector conferring hygromycin B resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
Aminoglycoside phosphotransferase
UseCRISPRExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAPM-miR30-IFIH1-ts3
Plasmid#174261PurposeIFIH1 knockdownDepositorAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF806-shABC1
Plasmid#186713PurposeExpresses dox-controlled miR-E shRNAs (UT4GEPIR). Multi-miR shRNAs targeting A-RAF, B-RAF, and C-RAF (shABC1 = shARAF.381-shBRAF.2015-shCRAF.2446). The shABC2 set is better than shABC1.DepositorAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV-EF1aGFP2AKAT7-linker-mAID-W
Plasmid#159294PurposeLentiviral vector expressing GFP and KAT7 (gRNA-resistant, mAID-tagged) driven by human EF1a promoterDepositorInsertKAT7 (KAT7 Human)
UseLentiviralTagsmAID (auxin-inducible degron)-taggedExpressionMammalianMutationCRISPR sites mutated (gRNA ID. 5 and A10)Promoterhuman EF1a promoterAvailable SinceOct. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
BII-Sh-FUCCI-Luc
Plasmid#133364PurposePiggybac vector for shRNA-mediated knockdown, co-expressed with FUCCI cell cycle reporterDepositorInsertClover-Geminin-IRES-mKO2-Cdt1
TagsHA-tagged Clover-GemininExpressionMammalianMutationN/APromoterCMV enhancer and hEf1a (CpG free)Available SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO-PHB-4
Plasmid#122231PurposeExpresses shRNA targeting the 3' UTR of human PHBDepositorAvailable SinceAug. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
PSUPER-1660s(hPot1)
Plasmid#11132DepositorInsertRNAi vector for human protection of telomeres 1(control for 1660) (POT1 Human)
UseRNAiExpressionMammalianMutationN/AAvailable SinceMarch 3, 2006AvailabilityAcademic Institutions and Nonprofits only -
PSUPER-344s(hPot1)
Plasmid#11134DepositorInsertRNAi vector for human protection of telomeres 1(control for 344) (POT1 Human)
UseRNAiExpressionMammalianMutationN/AAvailable SinceMarch 3, 2006AvailabilityAcademic Institutions and Nonprofits only -
pAH750
Plasmid#91212Purposeprotoplast vector expressing 2 gRNAs targeting tomato ARF8A (AtU6 and AtSL7 promoters, structurally optimized gRNA scaffolds)DepositorInsert2 gRNAs targeting tomato ARF8A
UseCRISPRExpressionPlantAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTC363
Plasmid#91211Purposeprotoplast vector expressing 2 gRNAs targeting tomato ARF8A (AtU6 and AtU6 promoters)DepositorInsert2 gRNAs targeting tomato ARF8A
UseCRISPRExpressionPlantAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTC303
Plasmid#91210Purposeprotoplast vector expressing 2 gRNAs targeting tomato ARF8A (AtU6 and AtSL7 promoters)DepositorInsert2 gRNAs targeting tomato ARF8A
UseCRISPRExpressionPlantAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
Human CRISPR Knockout Pooled Library (H3)
Pooled Library#133914PurposeCRISPR gRNA knockout pooled library for targeting the human genome - version H3DepositorExpressionMammalianSpeciesHomo sapiensUseCRISPR and LentiviralAvailable SinceJan. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTC441
Plasmid#91218Purposeprotoplast vector for targeted deletion of MLO gene in barley (PvUbi1 promoter driving the gRNA array)DepositorInsertgRNAs targeting MLO gene in barley
UseCRISPRExpressionPlantAvailable SinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTC437
Plasmid#91219Purposeprotoplast vector for targeted deletion of MLO gene in barley (CmYLCV promoter driving the gRNA array)DepositorInsertgRNAs targeting MLO gene in barley
UseCRISPRExpressionPlantAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pB–DualPE
Plasmid#235161PurposeFor plant prime editing including large DNA fragment editing in wheat plants or other monocotyledonsDepositorInsertsCsy4-P2A-Nls-nCas9-NC-nls-MLV-Nls
CmYLCV-epegRNA-CaMV poly(A) signal
UseCRISPRMutationDetailed in manuscriptAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
Reckleen_3_multieditdropout
Plasmid#233458PurposeLevel 2 RECKLEEN plasmid, genome editing of Klebsiella pneumoniaeDepositorInsertLevel 2 RECKLEEN plasmid, Ptac lambda Red operon, Ptet SpG cas9, J23117 acrIIA4
UseCRISPRAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti-DAG1
Plasmid#205149PurposeOverexpress DAG1DepositorInsertDystroglycan 1 (DAG1 Human)
UseLentiviralExpressionMammalianMutationCarries common missense variant c.41C>G (p.Ser…PromoterEF-1aAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On-ARNTL-shRNA1
Plasmid#166913PurposeLentivirus for inducible knockdown of human ARNTL(BMAL1)DepositorAvailable SinceMarch 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On-ARNTL-shRNA2
Plasmid#166914PurposeLentivirus for inducible knockdown of human ARNTL(BMAL1)DepositorAvailable SinceMarch 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
LLP618_αGCN4-KRAB-CO
Plasmid#211782PurposeSunTag counterpart binding domain, aGCN4, fused to transcriptional repressor KRAB, with GFP selectionDepositorInsertaGCN4-mCherry
Tags3xTy1ExpressionMammalianMutationLast 300 bp codon-optimised (CO) to detect mCherr…PromoterpEF1a and pSV40Available SinceDec. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-nt
Plasmid#195343PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed nonsense non-targeting gRNADepositorInsertsecTadA(8e)-SpCas9-NG
gRNA gtgcacgacgccgtatgcga
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-EF1a-KRAB-dCas9-P2A-BlastR BFP-guide1
Plasmid#118157PurposeCRISPRi negative control. Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the EF1a core promoter, and sgRNA1 against the BFP CDSDepositorInsertKRAB-dCas9-P2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterEF1a core and U6Available SinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTER GAMMA-TUBULIN shRNA Human
Plasmid#87955Purposereduced the expression of gamma-tubulin in human cellsDepositorInsertsh gamma-tubulin (TUBG1 Human)
TagsNo-tagExpressionMammalianMutationThe protein is a sh-gamma-tubulin resistant gene.…Available SinceOct. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
MLM3636-Prnp-CDS-Neg
Plasmid#61856PurposeExpresses a gRNA plasmid targeting the prion gene's exon 3, negative strandDepositorAvailable SinceFeb. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
MLM3636-Prnp-CDS-Pos
Plasmid#61857PurposeExpresses a gRNA plasmid targeting the prion gene's exon 3, positive strandDepositorAvailable SinceFeb. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET-FLAG-SpCas9-HF1-plus
Plasmid#126775PurposeExpression of increased fidelity SpCas9-HF1-plus in bacterial cells. Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with close to the same fidelity as SpCas9-HF1.DepositorInsertSpCas9-HF1-plus
UseCRISPRTags3xFLAG, 6xHis, MBP, and NLSExpressionBacterialMutationN497A; Q695A; Q926A; amino acids 1005-1013 replac…PromoterT7Available SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL3-sgACSL3.C-Cas9-P2A-Puro
Plasmid#129412PurposeEncoding Cas9 and sgACSL3.C for CRISPR/Cas9 mediated HDR tagging of endogenous human ACSL3 C-terminusDepositorInsertSpCas9 and sgACSL3.C (ACSL3 Human)
UseCRISPRTagsP2A-PuroExpressionMammalianPromoterhU6Available SinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLC-Flag-UBE2G1 sg2R-P2A-Hygro
Plasmid#124299PurposeLentiviral vector for expression of Flag tagged UBE2G1-P2A-Hygro casette from a CMV promoter. UBE2G1 cDNA contains silent mutations to disrupt a sgRNA binding site.DepositorInsertUBE2G1 (UBE2G1 Human)
UseLentiviralTagsFlagExpressionMammalianMutationseveral silent mutations to disrupt sgRNA targeti…PromoterCMVAvailable SinceJuly 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCCLc-U6-shHMGA2.2-PGK-dTomato
Plasmid#89605PurposeSilencing Hmga2 in human cellsDepositorAvailable SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSc2
Plasmid#80437PurposeExpresses eGFP along with an U6 promoter driven gRNA which cleaves the plasmid in-cellDepositorInsertssp Cas9 gRNA
eGFP
UseCRISPRExpressionMammalianPromoterCMV and U6Available SinceSept. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDECKO-mCherry TFRC_B
Plasmid#78544PurposeExperimental plasmidDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralExpressionMammalianPromoterU6 and U6 (for expressing sgRNA)Available SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDECKO-mCherry MALAT1_Exon.4
Plasmid#78543PurposeExperimental plasmidDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralExpressionMammalianPromoterU6 and U6 (for expressing sgRNA)Available SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDECKO-mCherry MALAT1_Exon.2
Plasmid#78541PurposeExperimental plasmidDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralExpressionMammalianPromoterU6 (for expressing sgRNA) and U6 promoterAvailable SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-Pur-dCas9-KRAB-MeCP2_hU6-NORAD
Plasmid#196086PurposeInducible CRISPRi vector conferring puromycin resistance, expressing gRNA targeting lncRNA NORAD.DepositorInsertgRNA targeting lncRNA NORAD
UseCRISPRExpressionMammalianMutationCloned using SapI sites - destroyed after inserti…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-FCGRT-Fc(DAPA)-AviTag-6xHis
Plasmid#156820PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertFCGRT (FCGRT Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-Cherry-Anillin deltaMyosin binding domain
Plasmid#187275PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin delta Myosin binding domainDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryMutationdeltaMyosin binding domainPromoterU6, CMVAvailable SinceSept. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGLS
Plasmid#110319PurposeshGLS (Target CAACTGGCCAAATTCAGTC), silence human GLS gene and express monomeric Kusabira-Orange2DepositorInsertGLS Glutaminase (GLS Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only