We narrowed to 10,034 results for: Pol
-
Plasmid#125169PurposeExpresses human MTF2 in insect cells, under a C3-cleavable (PreScission Protease) N-terminal hexahistidine-MBP tag.DepositorAvailable SinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pAc-C Med12His
Plasmid#49240Purposeexpresses human Med12 with His tag in insect cellsDepositorAvailable SinceNov. 6, 2013AvailabilityAcademic Institutions and Nonprofits only -
p3E-WPRE-SV40-pA (JDW 922)
Plasmid#224545PurposeA Gateway compatible 3' entry clone containing a woodchuck herpes simplex virus regulatory element (WPRE) to stabilize mRNA upstream of an SV40 polyADepositorInsertWPRE-SV40-pA
UseGateway CloningAvailable SinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTEF:ATP
Plasmid#92179PurposeHO-TEF1p-ATeam1.03-KanMX4-HO. Codon optimized for yeast version of the ATeam1.03 ATP FRET sensor (originally from Imamura et al. PNAS, 2009 ), expressed via the TEF1 promoter. HO locus integration.DepositorInsertATeam1.03 codon optimized for yeast (Saccharomyces cerevisiae)
UseIntegration and expression into yeast.TagsYeast codon optimized mseCFP (donor) and cp173-mV…ExpressionYeastPromoterTEF1pAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKb-TnpB2
Plasmid#215334PurposeISDra2 expression driven by PolII promoter ; 20 bp guide RNA can be cloned in BsaI siteDepositorInsertRice codon optimized ISDra2 TnpB
TagsNot applicableExpressionPlantPromoterRice ubiquitin promoter for TnpB and maize ubiqui…Available SinceOct. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-MYO7A-TAIL
Plasmid#89585PurposeExpression plasmid for a positive control bait protein in NanoSPD 2.0 assays.DepositorInsertMYO7A (Myo7a Mouse)
TagsEGFPExpressionMammalianMutationTruncation encoding amino acids 870-2166 of MYO7A…PromoterCMVAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EFS-FLTID-GSQ-RBXN-P2A-BLAST
Plasmid#208041PurposeEnables constitutive expression of TurboID alone; RBXN represents a EcoR1-BsiW1-Xba1-Not1 polylinker; selection with blasticidinDepositorInsertTurboID
UseLentiviralPromoterEFSAvailable SinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA6-N-3XFLAG-Dvl2
Plasmid#123587DepositorAvailable SinceJuly 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-Syn-NS1
Plasmid#175276PurposeAAV vector mediating bicistronic expression of NS1 gene of YFV-17D and dTomato with NLSDepositorInsertNonstructural protein 1 (NS1) of YFV-17D; NLS-dTomato (POLY Yellow fever virus strain 17D)
UseAAVTagsNLS-dTomato (P2A cleavage)PromoterSynapsinAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFB1.HMBP.PrS.PHF1
Plasmid#125167PurposeExpresses human PHF1 in insect cells, , under a C3-cleavable (PreScission Protease) N-terminal hexahistidine-MBP tag.DepositorAvailable SinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
KAT14-pDEST10
Plasmid#118382PurposeHIS-tagged insect cell expression vector with KAT14.DepositorAvailable SinceMay 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1 human full-length CENP-E-mNeon-6xHis
Plasmid#180484PurposepFastBac1 human CENP-E-mNeon-His, containing a 3c protease cleavage site between mNeon and His tag. Codon optimized for expression in Sf9 cellsDepositorInsertCENP-E (CENPE human, Human, Synthetic)
TagsmNeon-6xHisExpressionInsectPromoterpolyhedrin promoterAvailable SinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-TRE-NS1-dTomato
Plasmid#175278PurposeAAV vector mediating inducible bicistronic expression of NS1 gene of YFV-17D and dTomatoDepositorInsertNS1; dTomato (POLY Yellow fever virus strain 17D)
UseAAVTagsdTomato (from bidirectional promoter)Promoterbidirectional TRE promoterAvailable SinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shLuc.mKO2
Plasmid#85224PurposeshLuc (Target TTACGCTGAGTACTTCGA) for silencing luciferase gene as a control and express monomeric Kusabira-Orange2.DepositorInsertFirefly Luciferase
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFB-GST-IRP2
Plasmid#226621PurposeExpresses human IRP2 in insect cellsDepositorAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLD003-pCMV-APOBEC-Cas9(D10A)-rPB(8kD)
Plasmid#165445PurposeExpresses ACX, rPB(8kD) in mammalian cellsDepositorInsertAPOBEC-nCas9-rPB(8kD)
ExpressionMammalianAvailable SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
MmEos3.2
Plasmid#203754PurposeEncodes the membrane anchor of Src including the first 15 resideues of the N terminus, with 1 myristoylation and short polybasic sequence, with mEos3.2 fused to the C terminus. Used as a fluorescent plasma membrane probe.DepositorAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAct-FRT-FRT3-stop-FRT-LexGAD-FRT3-Gal4 attB
Plasmid#52890Purpose"CoinFLP-LexGAD/Gal4" - Expresses LexGAD or Gal4 from actin promoter downsteam of transcriptional stop. Recombination by FLP excises FRT-FRT pair to express LexGAD, or FRT3-FRT3 pair to express Gal4.DepositorInsertsExpressionInsectAvailable SinceJan. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFAST-BAC BAF57/SMARCE1-His
Plasmid#177861PurposeTransfer vector to generate recombinant baculovirus expressing BAF57/SMARCE1-His proteinDepositorInsertSMARCE1 (SMARCE1 Human)
TagsHis tag at C-terminus with GGGGS linkerExpressionInsectPromoterpolyhedrinAvailable SinceDec. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCS2+-Pard3-EGFP-PIF6
Plasmid#154914PurposeFull length zebrafish Pard3 (Gene ID: 403050), tagged with EGFP fluorescent protein and Arabidopsis PIF6 (as in construct Addgene ID 154913).DepositorInsertpar-3 family cell polarity regulator alpha, b (pard3ab Zebrafish)
UseXenopus/avian/zebrafishTags1-100 amino acids of Arabidopsis PIF6 and EGFPExpressionMammalianPromoterCMVAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1_GI.1_N116C-G193C
Plasmid#162580PurposeExpresses norovirus GI.1 VP1 protein with mutations N116C-G193C in Sf9 insect cellsDepositorInsertVP1 protein from human norovirus GI.1
ExpressionInsectMutationAsparagine 116 was mutated to Cysteine and Glycin…PromoterpolyhedrinAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKE13-ISceI-fabp10a:CreERT2
Plasmid#198242PurposeFor I-SceI-mediated transgenesis in zebrafish; fabp10a promoter driving tamoxifen-inducible Cre recombinaseDepositorInsertsUseZebrafish transgenesisAvailable SinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFastBacI-KDAC6
Plasmid#224346PurposeExpresses human KDAC6 (HDAC6) in insect cellsDepositorAvailable SinceOct. 22, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTYB11-PTBP1-RRM2CCtoSS
Plasmid#89154Purposerecombinant expression of PTBP1-RRM2 C250S,C251S in e.coliDepositorInsertPolypyrimidine Tract Binding Protein 1 RNA Recognition Motif 2 mutant C250S, C251S (PTBP1 Human)
TagsIntein and chitin binding domainExpressionBacterialMutationmutations: Cys 250 to Ser, Cys 251 to SerPromoterT7Available SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET26b(+)-ATI_QconCAT_1
Plasmid#163957PurposeExression of ATI QconCAT protein in E. coli expression strains (BL21). Encodes a concatemer of tryptic peptides from wheat amylase/trypsin inhibitors. Used as standard for LC-MS-based quantification.DepositorInsertATI QconCAT
Tagspolyhistidine tagExpressionBacterialPromoterT7 promoterAvailable SinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1_GI.1_Q62C-A140C
Plasmid#162581PurposeExpresses norovirus GI.1 VP1 protein with mutations Q62C-A140C in Sf9 insect cellsDepositorInsertVP1 protein from human norovirus GI.1
ExpressionInsectMutationGlutamine 62 changed to Cysteine and Alanine 140 …PromoterpolyhedringAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGS-CD64-2
Plasmid#109191PurposeEncodes full-length engineered CD64 with C-terminal Twin-Strep tag to be expressed in a baculovirus/insect cell expression systemDepositorInsertFull-length engineered CD64, derived from human CD64
TagsTwin-StrepExpressionInsectMutationengineered for efficient expression, see publicat…PromoterPolyhedrinAvailable SinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgCOQ2
Plasmid#186025Purposeknock out COQ2 in mammalian cellsDepositorAvailable SinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
tRNA-gRNA position [D1_n-1] (GB1208)
Plasmid#75409PurposetRNA and scaffold for the assembly of GBoligomers for the first position (positon [D1_n-1]) of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter (2-part multiplexing)DepositorInserttRNA-gRNA position [D1_n-1]
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFastBac(His10-Shp2)
Plasmid#177899PurposeBaculo expression of His10 tag fused to human Shp2DepositorAvailable SinceApril 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.1.mKO2
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCR4-Dact1(1250-1601)
Plasmid#52046PurposeTo generate mRNA in situ probe against mouse Dact1 (Probe C in PMID 17013874). For antisense cut with Spe1, transcribe with T7. For sense cut with Not1, treat with T4 polymerase, transcribe with T3.DepositorInsertDact1(1250-1601) (Dact1 Mouse)
ExpressionBacterialAvailable SinceApril 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
ArpC3-FLAG_pLib
Plasmid#173680PurposeArpC3 subunit of the Human Arp2/3 complex in a library vector for the biGBac system of insect expressionDepositorInsertArpC3 (ARPC3 Human)
TagsTEV cleavage site and FLAG tagExpressionInsectPromoterpolyhedrinAvailable SinceSept. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
ArpC1_pLib
Plasmid#173678PurposeArpC1 subunit of the Human Arp2/3 complex in a library vector for the biGBac system of insect expressionDepositorAvailable SinceSept. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
tRNA-gRNA position [n] (GB1207)
Plasmid#75408PurposetRNA and scaffold for the assembly of GBoligomers for the last position (positon [n]) of a polycistronic tRNA-gRNA (2- and 3-part multiplexing)DepositorInserttRNA-gRNA position [n]
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET28a-PTBP1-RRM12CCtoSS
Plasmid#89155PurposeRecombinant expression of PTBP1-RRM12 C250S,C251S in E.coliDepositorInsertPolypyrimidine Tract Binding Protein 1 RNA Recognition Motif 1+2 mutant C250S, C251S (PTBP1 Human)
Tagshexa HisExpressionBacterialMutationmutations: Cys 250 to Ser, Cys 251 to SerPromoterT7Available SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
tRNA-gRNA position [2_n-1] (GB1206)
Plasmid#75407PurposetRNA and scaffold for the assembly of GBoligomers for the intermediate position (positon [2_n-1]) of a polycistronic tRNA-gRNA (3-part multiplexing)DepositorInserttRNA-gRNA position [2_n-1]
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pfast bac cry1myc
Plasmid#51892PurposeBackbone plasmid is pfastBacHTa from invitrogenDepositorAvailable SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
tRNA-gRNA position [D1_2] (GB1205)
Plasmid#75406PurposetRNA and scaffold for the assembly of GBoligomers for the first position (positon [D1_2]) of a polycistronic tRNA-gRNA regulated by the dicot U6-26 or U6-1 promoter (3-part multiplexing)DepositorInserttRNA-gRNA
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pfast bac Rbx-HA
Plasmid#51893PurposeBackbone plasmid is pfastBacHTa from invitrogenDepositorAvailable SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only