We narrowed to 8,450 results for: set
-
Plasmid#139095PurposeExpresses human codon-optimized inactive SpCas9-NG fused to a transcriptional repressor KRAB in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a barcode downstream of sgRNA cassette.DepositorInsertKRAB-dSpCas9-NG
UseCRISPR and LentiviralTagsExpressionMammalianMutationD10A, H840A, L1111R, D1135V,G1218R, E1219F, A1322…PromoterAvailable sinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hyg-Snrnp40-CRISPR-resistant
Plasmid#134251PurposeLentivector encoding CRISPR-resistant Snrnp40DepositorInsertSnrp40 (Snrnp40 Mouse)
UseLentiviralTagsExpressionMammalianMutationmutated coding sequence “gataactatgcgacgttgaa” to…PromoterEF1aAvailable sinceMarch 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_hE2F7mg_PP7-tag
Plasmid#73078Purposehuman E2F7 minigene (exons 11,12,13/introns cassette) with PP7-tag on 5'-endDepositorInsertE2F7 (E2F7 Human)
UseTags5'-PP7-tag RNAExpressionMammalianMutationpartial gene, exons 11,12,13 spaced by intronsPromoterAvailable sinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEM-NLS-BirA-2A-mCherry-SV40pA-FKF
Plasmid#79889PurposeDonor cassette containing HA-tagged biotin ligase (BirA) with NLS, a Thosea asigna virus peptide (2A), mCherry protein and SV40 polyA tail, followed by FRT site-flanked Kanamycin selection geneDepositorInsertHA-tagged NLS-BirA, 2A, mCherry protein and SV40 polyA, followed by FRT site-flanked Kanamycin selection gene
UseTagsExpressionBacterialMutationPromoterAvailable sinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGEM BirA-2A-Citrine-SV40pA-FRT-Kan-FRT
Plasmid#89890PurposeBAC donor construct containing 3XHA-tagged BirA, a ribosome skipping motif - 2A, Citrine reporter, polyadenyation signal, followed by FRT recombination sites flanking kanamycin selection cassette.DepositorInsertHA-BirA-2A-citrine
UseUnspecifiedTagsCitrineExpressionMutationPromoterAvailable sinceAug. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
FRT1-His-H2B-Cherry-2A (IG156)
Plasmid#99622PurposeTo clone gene of interest downstream of FRT1-His-H2B-Cherry-2A cassetteDepositorInsertHis-H2B-Cherry
UseTagsExpressionMammalianMutationPromoterAvailable sinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
Mc4r->M71-IRES-tauGFP ACNF TV
Plasmid#105072PurposeTargeting vector: the coding sequence of M71 is replaced by the sequence encoding amino acids 1-333 of Mc4r and an IRES-tauGFP followed by ACNF cassetteDepositorInsertMc4r->M71-IRES-tauGFP-ACNF (Mc4r Mouse)
UseMouse TargetingTagsExpressionMutationPromoterAvailable sinceNov. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_hE2F7mg_2ntmut
Plasmid#73074Purposehuman E2F7 minigene (exons 11,12,13/introns cassette) with mutated snord27 binding siteDepositorInsertE2F7 (E2F7 Human)
UseTagsExpressionMammalianMutationpartial gene, exons 11,12,13 spaced by introns, 2…PromoterAvailable sinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TNT4-Zfr-P2A-HA-luciferase
Plasmid#223188PurposePlasmid containing the Zfr/Firefly luciferase cassette. Translation of luciferase is controlled by splicing modulation of the Zfr by risdiplam.DepositorInsertluciferase (LOC116160065 firefly)
UseAAVTagsHA and engineered P2AExpressionMutationPromoterTNNT2Available sinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
MKC175_HBA1reg(synEPOR)
Plasmid#232413PurposeAAV production plasmid for HBA1 UTRs vector from Fig. 3 that mediates HDR at HBA1 locus using HBA1 sg5 gRNA. HBB gene includes introns; HBA1 UTRs flank H+C15BA1 cassette. HAs are ~400bp each.DepositorInsertTruncated Erythropoietin Receptor (EPOR Human)
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-chr20-49345720-gRNA1
Plasmid#232623PurposeLentiviral plasmid expressing gRNA targeting the enhancer region in Chr20:49345720 (hg38) locus with lentiGuide-Hygro-eGFP (Addgene #99375) as backbone.DepositorInsertS. pyogenes sgRNA cassette
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-chr20-49345720-gRNA2
Plasmid#232624PurposeLentiviral plasmid expressing gRNA targeting the enhancer region in Chr20:49345720 (hg38) locus with lentiGuide-Hygro-eGFP (Addgene #99375) as backbone.DepositorInsertS. pyogenes sgRNA cassette
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-chr20-49345720-gRNA3
Plasmid#232625PurposeLentiviral plasmid expressing gRNA targeting the enhancer region in Chr20:49345720 (hg38) locus with lentiGuide-Hygro-eGFP (Addgene #99375) as backbone.DepositorInsertS. pyogenes sgRNA cassette
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
qTAG-KO-Puro-TP53
Plasmid#227319PurposeDonor template for 2A-Puro insertion into the N-terminus of the TP53 locus. For selectable p53 knock-out. To be co-transfected with sgRNA plasmid px330-TP53 (Addgene #227318)DepositorInsertTP53 Homology Arms flanking a 2A-Puro Cassette (TP53 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mStayGold-EFS-Blast-ARL13B
Plasmid#227278PurposeDonor template for mStayGold-EFS-Blast insertion into the C-terminus of the ARL13B locus. For cilia visualization. To be co-transfected with plasmid pX330-PITCh-ARL13B (Addgene #227276)DepositorInsertARL13B Homology Arms flanking a mStayGold-EFS-Blast Cassette (ARL13B Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mStayGold-EFS-Puro-CEP192
Plasmid#227290PurposeDonor template for mStayGold-EFS-Puro insertion into the C-term of CEP192 locus. For pericentriolar material visualization. To be co-transfected with sgRNA plasmid px330-PITCh-CEP192 (Addgene #227288)DepositorInsertCEP192 Homology Arms flanking a mStayGold-EFS-Puro Cassette (CEP192 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA324
Plasmid#215953PurposeFragmid fragment: (guide cassette) guide expression; reverse orientation; positive control cell surfaceDepositorHas ServiceCloning Grade DNAInsertrev{U6_v1; DR_v0[EnAs]; sgCD46_v4[EnAs]; DR_v1[EnAs]; sgCD47_v2[EnAs]; DR_v2[EnAs]; sgCD55_v4[EnAs];DR_v3[EnAs];sgCD81_v4[EnAs]}
UseCRISPR; FragmentTagsExpressionMutationPromoterAvailable sinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
B2M-SDMutation-EhT
Plasmid#215546PurposeDonor plasmid to introduce splice donor mutation on the first intron of human B2M locus to mediate knock-outDepositorInsertB2M homologous recombination arms (Mutation on right HA) and EF1alpha-drived hygromycin-NLS-tdTomato selection cassette (B2M Human)
UseCRISPRTagsExpressionMutationThe second base of the first intron of B2M (From …PromoterAvailable sinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
B2M-SDMutation-EPG
Plasmid#215545PurposeDonor plasmid to introduce splice donor mutation on the first intron of human B2M locus to mediate knock-outDepositorInsertB2M homologous recombination arms (Mutation on right HA) and EF1alpha-drived puromycin-GFP selection cassette (B2M Human)
UseCRISPRTagsExpressionMutationThe second base of the first intron of B2M (From …PromoterAvailable sinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Blast-moxGFP-LMNB1
Plasmid#207772PurposeDonor template for Blast-2A-moxGFP insertion into the N-terminus of the LMNB1 locus for nuclear envelope visualization. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a Blast-moxGFP Cassette (LMNB1 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 14, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
PB-PARP1-del.p119K120S–eGFP
Plasmid#211554PurposeA piggyBac vector containing CMV-PARP1-del.p119K120S-eGFP-IRES-Neo cassette.DepositorInsertPARP1 (PARP1 Human)
UsePiggybacTagseGFPExpressionMammalianMutationdeletion of amino acids 119K 120SPromoterCMVAvailable sinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Blast-miniTurbo-LMNB1
Plasmid#207774PurposeDonor template for Blast-2A-miniTurbo insertion into the N-terminus of the LMNB1 locus. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a Blast-miniTurbo Cassette (LMNB1 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-N-Blast-mNeon-ACTB
Plasmid#207751PurposeDonor template for Blast-2A-mNeon insertion into the N-terminus of the ACTB locus for actin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-ACTB Addgene #207748DepositorInsertACTB Homology Arms flanking a Blast-mNeon Cassette (ACTB Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceNov. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
B52_puro_gRNA_3418711_KCNB2
Plasmid#197558PurposegRNA targeting upstream region of KCNB2 (site 3418711, control for epigenetic targeting)DepositorInsertupstream KCNB2 promoter gRNA (Kcnb2 Rat)
UseGrna with puromycin selectionTagspuromycin resistance cassette under CMV promotionExpressionMammalianMutationPromoterU6Available sinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-Ef1A-Myc-POLB(PAMmut)
Plasmid#176150PurposeN-terminus Myc-tagged POLB containing a mutation in the PAM site used by POLB gRNA1 & a hygromycin resistance cassetteDepositorInsertPolB (POLB Human)
UseLentiviralTagsMYCExpressionMammalianMutationMutation in the PAM site used by POLB gRNA1PromoterEF1AAvailable sinceFeb. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-CMV-EGFP-PolB(K72A)-PAMmut-Hygro
Plasmid#176087PurposeEGFP fused to the N-terminus of POLB containing the mutation Lys72Ala, a mutation in the PAM site used by POLBKOg1 & a hygromycin resistance cassetteDepositorInsertPolB (POLB Human)
UseLentiviralTagsEGFPExpressionMammalianMutationMutation in Lys72 to Ala, and mutation in the PAM…PromoterCMVAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1A-XL1/BRCT1-Linker-eGFP
Plasmid#176084PurposeEGFP fused to the C-terminus of a XL1/BRCT1 domain & a hygromycin resistance cassetteDepositorInsertXL1/BRCT1 (XRCC1 Human)
UseLentiviralTagsEGFPExpressionMammalianMutationPromoterEF1AAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
Donor-CD55-NeoR
Plasmid#153551PurposeUsed as a donor vector for the targeted knock-in of a CD55 mutation. This plasmid carries a neomycin resistance gene cassetteDepositorInsertmutant CD55 (a 1415-bp fragment from intron 3, exon 4 and intron 4, with a 1-bp mutation in exon 4), divided into 5' and 3' arms
UseAAV and Cre/Lox; Donor plasmid/targeting vectorTagsN/AExpressionMutationa 1-bp mutation in exon 4PromoterNo promoterAvailable sinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha1 U6-26-1gRNA-DFR 2.1 (GB1838)
Plasmid#160625PurposeGB-cassette for the expression of a guide RNA targeting the DFR promoter with 2.1 Ms2 aptamer in the 3' of the scaffoldDepositorInsertU6-26-1gRNA-DFR 2.1
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationBsaI and BsmBI sites removedPromoterU6-26Available sinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
Donor-PIGA-NeoR
Plasmid#153549PurposeUsed as a donor vector for the targeted knock-in of a PIGA mutation. This plasmid carries a neomycin resistance gene cassetteDepositorInsertmutant PIGA (a 1,991-bp fragment from intron 5 and exon 6 with a 3-bp mutation in exon 6), divided into 5' and 3' arms
UseAAV and Cre/Lox; Donor plasmid/targeting vectorTagsN/AExpressionMutationa 3-bp mutation in exon 6PromoterNo promoterAvailable sinceDec. 11, 2020AvailabilityAcademic Institutions and Nonprofits only