We narrowed to 1,708 results for: CAG promoter
-
Plasmid#227456Purpose3-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Prdm8 promoter Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
B52 + SMARCAL1 sgSTOP
Plasmid#100715PurposeB52 plasmid expressing SMARCAL1 sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting SMARCAL1 (cloned using BbsI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
INS-CRa-Lsg-MS2
Plasmid#247478PurposesgRNA for INS activation cloned into LsgRNA-MS2 backboneDepositorAvailable SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
B52 + PARP4 sgSTOP
Plasmid#100711PurposeB52 plasmid expressing PARP4 sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting PARP4 (cloned using BbsI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
B52 + PIK3R1 sgSTOP
Plasmid#100714PurposeB52 plasmid expressing PI3KR1 sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting PIK3R1 (cloned using BbsI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDF0430 huDisCas7-11-S1006-GGGS-D1221-U6-pro-Gluc
Plasmid#186987PurposeAAV transgene plasmid for Cas7-11-S1006-GGGS-D1221, with U6 promoter-driven expression of Gluc crRNA guideDepositorInsertcas7-11-s1006-gggs-d122, Gluc crRNA guide
UseAAVMutations1006-gggs-d1221 deletionAvailable SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRANS-Pho2-1/2-2-Csy4
Plasmid#161763PurposepTRANS T-DNA vector with nptII selection and 35S:Cas9 with 6x Csy4-spliced gRNAs and rolD:TREX2 targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pTRANS_220 - #91113)DepositorInsertCas9 and gRNAs
ExpressionPlantPromoterCmYLCV PromoterAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTRANS-Pho2-1/2-2-tRNA
Plasmid#161762PurposepTRANS T-DNA vector with nptII selection and 35S:Cas9 with 6x tRNA-spliced gRNAs and rolD:TREX2 targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pTRANS_220 - #91113)DepositorInsertCas9 and gRNAs
ExpressionPlantPromoterCmYLCV PromoterAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDF0428 huDisCas7-11-R1045-GGGS-R1122-U6-pro-Gluc
Plasmid#186985PurposeAAV transgene plasmid for Cas7-11-R1045-GGGS-R1122, with U6 promoter-driven expression of Gluc crRNA guideDepositorInsertcas7-11-r1045-gggs-r1122, Gluc crRNA guide
UseAAVMutationr1045-gggs-r1122 deletionAvailable SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCrx-DsRed
Plasmid#13765DepositorAvailable SinceApril 20, 2007AvailabilityAcademic Institutions and Nonprofits only -
pSpyB-Tn7sg
Plasmid#248694PurposesgRNA expression vector - pBG35 promoter with Tn7sg negative control sgRNADepositorInsertTn7sg
ExpressionBacterialPromoterBG35Available SinceJan. 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-PDL1
Plasmid#159280PurposeHuman AAVS1 targeting vector for knockin of a CAGGS promoter-driven human PDL1/CD274 (cloned between AgeI and PacI). Targeted cells will be puromycin resistant.DepositorInsertHuman PDL1/CD274 (CD274 Human)
UseAAV; S1 knockin donor vectorExpressionMammalianPromoterCAGGSAvailable SinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNkx2-1#1/Cre
Plasmid#193221PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Nkx2-1 geneDepositorAvailable SinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
msEGFP-PACR_pRSETB
Plasmid#55775PurposeGenetically encoded caged Ca2+DepositorInsertPACR
Tags6xHis and msEGFPExpressionBacterialPromoterT7 promoterAvailable SinceJuly 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCR-U6-gRNA-miniCMV-TdTomato
Plasmid#192656PurposeA plasmid encoding miniCMV sgRNA and miniCMV-promoter-TdTomatoDepositorInsertTdTomato
ExpressionMammalianPromoterU6, miniCMVAvailable SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
hROSA26 CRISPR-pX330
Plasmid#105927PurposehROSA26 targeting CRISPR plasmidDepositorInserthROSA26 gRNA
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
miniCMV-iRFP670-24xMS2
Plasmid#238915PurposeContains miniCMV promoter expressing iRFP670 mRNA taged 24xMS2 motifDepositorInsertiRFP670-24xMS2
UseLentiviralExpressionMammalianPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCX-H2B-KikGR
Plasmid#98649PurposeExpresses a nuclear-localized photoconvertible green-to-red fluorescent proteinDepositorInsertKikGR
TagsH2BExpressionMammalianPromoterCMV-IE enhancer chick beta actin promoterAvailable SinceSept. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEX128·gRNA
Plasmid#187600PurposeTemplate for amplification of gRNA with Cas6 recognition siteDepositorInsertgRNA template
Promoterno promoterAvailable SinceJuly 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCY_gRNA_hPAX7-Pro_C3
Plasmid#160454PurposesgRNA targeting human PAX7 promoterDepositorInsertgRNA_hPAX7-Promoter_C3
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
phU6 ST
Plasmid#188712PurposesgRNA plasmid encoding hU6 promoter driving an anti-safe targeting sgRNADepositorInsertSafe Targeting sgRNA
UseCRISPR and Synthetic BiologyAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pmU6 ST
Plasmid#188713PurposesgRNA plasmid encoding mU6 promoter driving an anti-safe targeting sgRNADepositorInsertSafe Targeting sgRNA
UseCRISPR and Synthetic BiologyAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
phH1 ST
Plasmid#188715PurposesgRNA plasmid encoding hH1 promoter driving an anti-safe targeting sgRNADepositorInsertSafe Targeting sgRNA
UseCRISPR and Synthetic BiologyAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr2-miRFP703-dSal-VP16minADx3-hCRY2-NLS
Plasmid#241843PurposeExpresses an actuator of Opto-p53 in mammalian cells.DepositorInsertVP16
TagsCRY2 and miRFP703ExpressionMammalianMutationVP16 minimal activation domain x 3PromoterCAGGS promoterAvailable SinceSept. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCR-U6-gRNA-miniCMV-Nluc
Plasmid#192657PurposeA plasmid encoding miniCMV sgRNA and miniCMV-promoter-NlucDepositorInsertNluc
UseLuciferaseExpressionMammalianPromoterU6, miniCMVAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pmU6 NFATC2
Plasmid#188709PurposesgRNA plasmid encoding mU6 promoter driving an anti-NFATC2 sgRNADepositorInsertNFATC2 sgRNA
UseCRISPR and Synthetic BiologyAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLY105
Plasmid#130939PurposeEngineered sgRNA-LEA3 (2 BoxB aptamers) generator circuit including promoter Plux2DepositorInsertsgRNA-LEA3
UseSynthetic BiologyExpressionBacterialPromoterPlux2Available SinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPiggyBac_NTVE(PABP)
Plasmid#254463PurposeTransposon encoding doxycycline-inducible NTVE(PABP). Co-expression of PiggyBac transposase required. Tet-On 3G and green fluorescent protein mGreenLantern are co-expressed via the CAG promoter.DepositorInsertNTVE(PABP)
ExpressionMammalianPromoterTRE3GAvailable SinceMay 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPiggyBac_NTVE(PABP)-dVSVG-HA
Plasmid#254462PurposeTransposon encoding doxycycline-inducible NTVE(PABP) with HA tag. Co-expression of PiggyBac transposase required. Tet-On 3G and puromycin N-acetyltransferase are co-expressed via CAG promoter.DepositorInsertNTVE(PABP)_P2A_dVSV-G-HA
ExpressionMammalianPromoterTRE3GAvailable SinceMay 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPiggyBac_NTVE(PABP)-dVSVG-FLAG
Plasmid#254461PurposeTransposon encoding doxycycline-inducible NTVE(PABP) with FLAG tag. Co-expression of PiggyBac transposase required. Tet-On 3G and puromycin N-acetyltransferase are co-expressed via CAG promoter.DepositorInsertNTVE(PABP)_P2A_dVSV-G-FLAG
ExpressionMammalianPromoterTRE3GAvailable SinceMay 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
PBMBP-eGFP
Plasmid#40976DepositorInsertMBP promoter fragment (Mbp Mouse)
ExpressionMammalianAvailable SinceMay 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-scramble
Plasmid#62285Purposeexpression of scramble sgRNA from the arabinose-inducible promoterDepositorInsertscramble sgRNA
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A1T
Plasmid#62256Purposeexpression of A1T sgRNA from the arabinose-inducible promoterDepositorInsertA1T sgRNA
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A4NT
Plasmid#62261Purposeexpression of A4NT sgRNA from the arabinose-inducible promoterDepositorInsertA4NT sgRNA
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A3T
Plasmid#62260Purposeexpression of A3T sgRNA from the arabinose-inducible promoterDepositorInsertA3T sgRNA
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
B95(DE3) ΔA ΔfabR ΔserB
Bacterial Strain#197655PurposeThis strain is used for expressing phosphoserine-containing proteins using genetic code expansion without buildup of prematurely truncated protein.DepositorBacterial ResistanceNoneAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pU6_rd6_pegRNA_(PP7-C4-Q1)
Plasmid#232433PurposepegRNA with optimized 3' modifications to correct the rd6 mutationDepositorInsert3'-PP7-tagged pegRNA for rd6 correction driven by human U6 promoter
UseCRISPRPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(PRDM14_v32_7-6)-PGKpuroBFP-W
Plasmid#211983PurposeExpress gRNA against PRDM14 with puro and BFPDepositorInsertsgRNA targeting PRDM14 (PRDM14 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLeGO.sgGata1.4.RUNX1A.iG2
Plasmid#181976Purposegene knock out of mouse GATA1, overexpression of 3xFLAG-RUNX1A (human)DepositorAvailable SinceApril 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(PDLIM1_5-1)-PGKpuroBFP-W
Plasmid#211978PurposeExpress gRNA against PDLIM1 with puro and BFPDepositorInsertsgRNA targeting PDLIM1 (PDLIM1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(NANOG_g1)-PGKpuroBFP-W
Plasmid#211974PurposeExpress gRNA against NANOG with puro and BFPDepositorInsertsgRNA targeting NANOG (NANOG Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
Level 1 P4 TaU6 guide acceptor
Plasmid#165600PurposeGoldenGate (MoClo) Level 1 Position 4 TaU6 guide acceptor plasmidInsertTaU6 promoter::LacZ::sgRNA scaffold
UseCRISPR and Synthetic Biology; Sgrna acceptor with…Available SinceApril 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
Level 1 P3 TaU6 guide acceptor
Plasmid#165599PurposeGoldenGate (MoClo) Level 1 Position 3 TaU6 guide acceptor plasmidInsertTaU6 promoter::LacZ::sgRNA scaffold
UseCRISPR and Synthetic Biology; Sgrna acceptor with…Available SinceApril 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTomatoSlicer
Plasmid#221085PurposeDual-color splicing reporter expressing eGFP and tdTomato from the CMV early enhancer/chicken ß-actin (CAGGS) promoter.DepositorTypeEmpty backboneExpressionMammalianAvailable SinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-NEAT1pr_v2
Plasmid#97082PurposeEncodes an sgRNA that creates a DSB at the promoter of human NEAT1 geneDepositorInsertsgRNA NEAT1pr_v2
UseCRISPRPromoterU6Available SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
OA-1050V (wingless)
Plasmid#132424Purposeexpress arrays of gRNA targeting Wingless under dU6-3 promoterDepositorInsertwingless gRNA array
ExpressionInsectPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSM004
Plasmid#122937PurposeExpression of the marked mRNA under the control of substitutional promoters.DepositorInsertYML065W (Marked)
ExpressionYeastMutationYML065W: bp 52-63 GAGCAGGGAAAT to GAACAAGGTAACPromoter[tetO2]4inPgal1Available SinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
eMagB-iRFP-Mito
Plasmid#162250PurposeBlue-light dependent heterodimerization systemDepositorInserteMagB-iRFP-OMP25
ExpressionMammalianPromoterbeta-actin promoterAvailable SinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only