173,387 results
-
Plasmid#134914PurposesgRNA targeting GFP to be used in nanoblade systemDepositorInsertGFP
UseCRISPR and Synthetic BiologyPromoterU6Available SinceDec. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
VEGFR2-mCh
Plasmid#108854PurposeEncodes for human VEGFR2 fluorescently labeled with mCherry on the C-Terminus via a 3 amino acid (GGS) flexible linkerDepositorAvailable SinceMay 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pIRES2-EGFP Mer
Plasmid#14998DepositorAvailable SinceAug. 22, 2007AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E2-ChR2-mCherry (AAV1)
Viral Prep#135634-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-S5E2-ChR2-mCherry (#135634). In addition to the viral particles, you will also receive purified pAAV-S5E2-ChR2-mCherry plasmid DNA. Expression of ChR2-mCherry under the control of the E2 regulatory element. These AAV preparations are suitable purity for injection into animals.DepositorTagsmCherryAvailable SinceNov. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307-EF1a-ChR2[H134R]-mCherry-Puro-WPRE
Plasmid#125256Purpose3rd gen lentiviral expression of humanized ChR2 with H134R mutation fused to mCherry driven by EF1a promoter for optogenetic activation with puro selectionDepositorInserthChR2(H134R)
UseLentiviralTagsmCherryExpressionMammalianPromoterEF1a-forwardAvailable SinceMay 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pmiRGLO Dual-Luciferase-PDAP1-3'UTR
Plasmid#182251PurposeHuman PDAP1 3` UTR region containing 4x binding sites for miR-150 cloned downstream of luciferase reporter geneDepositorInsert3' UTR region of PDAP1 gene
UseLuciferaseExpressionMammalianAvailable SinceMarch 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_SLC52A3
Plasmid#132181PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC52A3 (C20orf54 Human)
ExpressionMammalianAvailable SinceOct. 25, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA3.1(+)-Flag-SOD1-G93A
Plasmid#235662PurposeExpress human SOD1-G93A in mammalian cellsDepositorInsertSOD1-G93A (SOD1 Human)
TagsFlag-tag at N-terminalExpressionMammalianMutationchanged Glycine 93 to alaninePromoterCMV promoterAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
p(+)MV-NSE-FlagrP-3g_haP-F497D-3p
Plasmid#58800PurposeExpresses recombinant measles virus with duplicated P gene. wt P gene and P-F497D gene are tagged with Flag and HA peptides and si1 (siGFP) and si2 (siP) target sequences, respectively.DepositorInsertMeasles virus antigenome
TagsFlag and HaPromoterT7Available SinceAug. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
HPV-31neo
Plasmid#153283PurposeNeomycin selectable HPV31 genomeDepositorInsertHPV-31 genome with Neo cassette
UseUnspecifiedMutationHindIII and CsiI site mutated from original Neo c…Available SinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
Mouse Metabolism Library
Pooled Library#163966PurposeKnockout library targeting mouse metabolic genes.DepositorUseCRISPR and LentiviralAvailable SinceJuly 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
nontarget S. pyogenes scaffold CARGO array
Plasmid#191319PurposeContains an array of nontargeting guide RNAsDepositorInsertArray of guide RNAs
UseCRISPRTagsmCherryExpressionMammalianAvailable SinceNov. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pC014 - LwCas13a-msfGFP
Plasmid#91902PurposeExpresses active LwCas13a for mammalian RNA targetingDepositorInsertLwCas13a
UseCRISPRTagsNLS and msfGFP-NLS-3xHAExpressionMammalianPromoterEF1aAvailable SinceDec. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn FLEx-loxp Kir2.1-2A-GFP
Plasmid#161574PurposeExpression of Kir2.1-2A-GFP in a Cre-dependent fashionDepositorAvailable SinceNov. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pETM33_Nsp16
Plasmid#156482PurposeBacterial expression of Sars-CoV2 Nsp16 protein with His-tag and GST-tagDepositorInsertNsp16 (ORF1ab Synthetic, Severe acute respiratory syndrome coronavirus 2)
TagsHis-GSTExpressionBacterialMutationGene insert is codon optimized for Ecoli.PromoterT7/LacOAvailable SinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-Neo-ISG15
Plasmid#80404Purposeoverexpression of ISG15DepositorAvailable SinceDec. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
AiO-Cas12a: All in one enAsCas12a expression and gRNA cloning backbone
Plasmid#228364PurposemU6-driven expression of enAsCas12a gRNAs with EF1a-enAsCas12a-2A-PuroDepositorTypeEmpty backboneUseCRISPR and Lentiviral; Enascas12a nuclease and en…ExpressionMammalianPromotermU6Available SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCODE
Plasmid#247473PurposePlasmid for constitutive expression of six tRNA encoding genes (argX, glyT, leuW, proL, argU, and ileX) in Escherichia coli, based on pSEVA121 backboneDepositorInsertargX, glyT, leuW, proL, argU, and ileX
ExpressionBacterialMutationRearrangement of tRNA operonPromoterJ23100Available SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CMV-Vega
Plasmid#246323PurposePhotostable genetically encoded voltage indicator for imaging in HEK293TDepositorInsertVega
ExpressionMammalianPromoterCMVAvailable SinceFeb. 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-synmiR-L-mRuby-Pro-EGFR-mEGFP-4×17
Plasmid#218265PurposeExpresses EGFR-mEGFP in mammalian cells regulated by a synthetic microRNA-based dosage compensation circuitDepositorInsertsynPolyA-synmiRL-mRuby-EF1a-CMVe_MeP-EGFR-mEGFP-MREL_4×17
UseAAV and Synthetic BiologyExpressionMammalianAvailable SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-synmiR-L-mRuby-Pro-EGFR-mEGFP-4×19
Plasmid#218267PurposeExpresses EGFR-mEGFP in mammalian cells regulated by a synthetic microRNA-based dosage compensation circuitDepositorInsertsynPolyA-synmiRL-mRuby-EF1a-CMVe_MeP-EGFR-mEGFP-MREL_4×19
UseAAV and Synthetic BiologyExpressionMammalianAvailable SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRPML1 V432P mScarlet-I
Plasmid#245041PurposeExpresses TRPML1 mutant with C-terminus mScarlet-I tag in mammalian cellsDepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-DjCas13d-T2A-mCherry-pA
Plasmid#192499PurposeTo express DjCas13dDepositorInsertDjCas13d
UseAAVMutationNoPromoterEFSAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV[Exp]-Bsd-CMV>hCDK11A
Plasmid#239212PurposeExpresses CDK11A in mammalian cell linesDepositorAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB-TRE3G-CCRB
Plasmid#236772PurposeA piggybac-based cloning vector containing TRE3G promoter followed by cloning site and CAG promoter-driven nuclear-localized Clover-P2A-rtTA-IRES-BSD.DepositorTypeEmpty backboneUsePiggybacExpressionMammalianPromoterTRE3G promoter, CAG promoterAvailable SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Con/Fon-Synaptophysin-10xMyc-WPRE
Plasmid#237446PurposeIntersectional expression of Myc-tagged synaptophysin in the presence of Cre and FlpDepositorInsertCon/Fon-Synaptophysin-10xMyc
UseAAVExpressionMammalianPromoterEF1aAvailable SinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR36(DjCas13d-SapI)-CMV-intron-MCS-pA
Plasmid#233031PurposeTo express a DjCas13d-compatible gRNADepositorInsertDjCas13d-compatible gRNA expression cassette
UseAAVAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-CasRx-P2A-mCherry-pA
Plasmid#233025PurposeTo Express HA tagged CasRX and mcherry from the mammalian EFS promoter. The CasRx and mCherry are separated by a P2A siteDepositorInsertCasRx/mCherry
UseAAVTagsmCherryAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
Antibody#222512-rAbPurposeAnti-Glypican 1 (Human) chimeric recombinant antibody with fused human variable and rabbit constant domains; specific for human GPC1. Does not cross-react with other GPCs.DepositorRecommended ApplicationsFlow Cytometry and ImmunocytochemistryReactivityHumanSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceNov. 5, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits
-
TFORF1019
Plasmid#143743PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMC-6-TaGRF-GIF-9
Plasmid#197747PurposePhytobrick (MoClo) Level 0 PartDepositorInsertTaGRF-GIF chimeric protein CDS
ExpressionPlantAvailable SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0760
Plasmid#141688PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDGB1a2+pNOS_Red-F_NOSt
Plasmid#170887PurposeGoldenBraid Transcriptional Unit - pNOS_Red-F_NOSt Forward orientationDepositorInsertRed-F
UseLuciferase and Synthetic BiologyExpressionPlantMutationp.S286Y Red mutantPromoterpNOSAvailable SinceAug. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
p6xUAS (GB0179)
Plasmid#68182PurposeProvides 6xUAS (upstream activating sequence) as a level 0 GoldenBraid partDepositorInsert6xUAS
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-ChRmine-oScarlet-KV 2.1-WPRE (AAV8)
Viral Prep#183519-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-CaMKIIa-ChRmine-oScarlet-KV 2.1-WPRE (#183519). In addition to the viral particles, you will also receive purified pAAV-CaMKIIa-ChRmine-oScarlet-KV 2.1-WPRE plasmid DNA. CaMKIIa-driven expression of ChRmine-oScarlet-KV 2.1. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCaMKIIAvailable SinceDec. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
myrAkt delta4-129
Plasmid#10841DepositorInsertAkt (AKT1 Human)
TagsHA and myrExpressionMammalianMutationDeletion of PH domain (aa4-129)PromoterSV40Available SinceFeb. 13, 2006AvailabilityAcademic Institutions and Nonprofits only -
CMV-CjABE8e
Plasmid#189929PurposePlasmid encoding CjABE8e driven by the CMV promoter for plasmid transfection.DepositorInsertCjABE8e
ExpressionMammalianMutationCjCas9 D8APromoterCMVAvailable SinceSept. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-mCherry (AAV2)
Viral Prep#114470-AAV2PurposeReady-to-use AAV2 particles produced from pAAV-Ef1a-mCherry (#114470). In addition to the viral particles, you will also receive purified pAAV-Ef1a-mCherry plasmid DNA. EF1a-driven mCherry expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsmCherryAvailable SinceNov. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET30-2-GAPDH
Plasmid#83910Purposestable overexpressionDepositorInsertglyceraldehyde-3-phosphate dehydrogenase (GAPDH Human)
Tags6x His tagsExpressionBacterialPromoterT7Available SinceOct. 21, 2016AvailabilityAcademic Institutions and Nonprofits only