We narrowed to 37,502 results for: crispr
-
Plasmid#52527Purposeserves as template for PCR-mediated fusion of U6-promoter with sgRNADepositorPublicationInsertDrosophila U6C promoter
UseCRISPR; Blunt cloning kitTagsT7-promoterExpressionInsectAvailable sinceApril 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHMGWA-Pa14Csy4H29A
Plasmid#41092DepositorInsertCsy4
TagsHis6-MBPMutationHis29Ala mmutation to abolish ribonuclease activi…PromoterT7Available sinceDec. 3, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-FLEX-SaCas9-U6-sgGrin1
Plasmid#124852PurposeMutagenesis of Grin1DepositorInsertGrin1 (Grin1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable sinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pYPQ134A
Plasmid#69276PurposeGolden Gate entry vector; 4th gRNA under AtU6 promoterDepositorTypeEmpty backboneUseCRISPRAvailable sinceSept. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
BB3cK_pGAP_23*_pTEF_Cas9
Plasmid#104909PurposehCas9 under control of Tef1 for direct cloning of HH-sgRNA-HDV PCR products and episomal expression in P. pastoris and G418 selectionDepositorInsertsHH - FS23 linker - HDV
human codon-optimized hcas9 sequence fused to a nuclear localization signal (NLS)
UseCRISPRExpressionYeastAvailable sinceJune 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
SunTag-FWAgRNA-4-22aa-TET1cd
Plasmid#106435PurposeSunTag CRISPR cas9 system that targets the TET1 catalytic domain to the FWA promoterDepositorInsertgRNA4_U6_NOS_TET1CD_2xNLS_1xHA__sfGFP_scFv_UBQ10_INSULATOR_UBQ10_dCAS9_1xHA_3xNLS_10xGCN422aa_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable sinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPbcas13b
Plasmid#89906PurposeBacterial expression for pbCas13b, driven by the lac promoter, and DR-spacer-DR sequence driven by js23119. New spacer sequences can be cloned in between the DRs by digesting the plasmid with BsaI.DepositorInsertCas13b
ExpressionBacterialPromoterLacAvailable sinceMay 12, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
U6-BbsI-DR_CMV-minidCas13X.1-REPAIRv2-BGHpA_CMV-EGFP-BGHpA
Plasmid#171383PurposeExpression vector for encoding a human codon-optimized minidCas13X.1-REPAIRv2 driven by CMV promoter,EGFP driven by CMV promoter and U6-driven crRNAs cloning site.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthumanized minidCas13X.1-REPAIRv2
TagsHAExpressionMammalianPromoterCMV, U6Available sinceJuly 12, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-SEP-GluA1 TKIT
Plasmid#169441PurposeExpression of 2 guides + donor DNADepositorInsertSuper ecliptic pHluorin (SEP)
UseAAV and CRISPRAvailable sinceJune 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6-Universal.Sth.dCas9
Plasmid#171088PurposeCRISPR interference. Recipient construct for cloning 20-nt spacers into the sgRNA scaffold compatible with Streptococcus thermophilus dCas9 (CRISPR1 system) via BsaI restriction sites.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsToxoplasma U6 upstream region – spacer cloning site - sgRNA scaffold (compatible with S. thermophilus Cas9 CRISPR1)
DHFR-TSc3
UseToxoplasma gondii expressionMutationNote: A S245F mutation is present but did not app…PromoterDHFR-TS (Toxoplasma gondii) and U6 (Toxoplasma go…Available sinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
ER50-SpCas9-ER50
Plasmid#85448PurposeExpresses SpCas9 fused to ER50 domain on both N- and C-termini in mammalian cellsDepositorInsertER50-SpCas9-ER50
UseAAVTagsdestabilized domain of estrogen receptor ligand b…ExpressionMammalianPromoterCbhAvailable sinceFeb. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
gRNA Cloning Vector Bbs I ver. 2
Plasmid#85586PurposeAn empty sgRNA expression vector. sgRNA sequence can be cloned into its Bbs I site. Its gRNA scaffold has efficient ver. 2 structure.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6Available sinceDec. 5, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
M3-M14-dCas9
Plasmid#134779PurposeExpression of fusion protein M3-M14-dCas9 in Mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertExpressionMammalianPromoterCMVAvailable sinceFeb. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pY003 (pFnCpf1_delta Cas)
Plasmid#69974PurposeExpresses FnCpf1 and spacers 1-4 of CRISPR array. Cas genes are removed.DepositorInsertFnCpf1 locus without Cas genes
UseCRISPRExpressionBacterialMutationCas genes are deleted from locusAvailable sinceOct. 8, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
P2061
Plasmid#186299PurposeExpresses LexA-HBD-B112 under the control of pAct1 and Cas9 under the control of LexA-HBD-B112+Beta-estradiol inducible promoterDepositorInsertsLexA-HBD-B112
Cas9
UseCRISPR and Synthetic BiologyExpressionBacterial and YeastPromoter2xLexop-minimalCyc1 and PACT1Available sinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgTS40
Plasmid#169630PurposepX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.DepositorInsertU6-driven gRNA expression and PCAG-driven SpCas9 expression
ExpressionMammalianPromoterU6 / PCAGAvailable sinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJMP3
Plasmid#79875PurposeBacillus subtilis sgRNA expression vector; integrates into thrCDepositorInsertsgRNA RR1
UseCRISPRExpressionBacterialPromotervegAvailable sinceSept. 16, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
YET1000: CAG-human dLbCpf1(D832A)-NLS-3xHA-3xFLAG-DmrA(X4)
Plasmid#104571PurposeMammalian expression vector for catalytically inactive Cpf1 from Lachnospiraceae bacterium (dLbCpf1) fused to four DmrA domainsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthuman codon optimized ‘dead’ Cpf1 fused to four DmrA domains
UseCRISPRTagsNLS-3xHA-3xFLAG-4xDmrAExpressionMammalianMutationD832APromoterCAGAvailable sinceJan. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330 Ctnnb1.1
Plasmid#59911PurposepX330 backbone expressing sgRNA targeting Ctnnb1 to edit mouse beta-Catenin. Expresses Cas9 from CBh promoterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting Ctnnb1 (Ctnnb1 Mouse)
UseCRISPRExpressionMammalianPromoterU6Available sinceMarch 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-dTAG-Puro
Plasmid#207727PurposeEmpty C-terminus donor cassette. Integrate homology arms to target the C-terminus insertion of a dTAG-2A-Puro cassetteDepositorTypeEmpty backboneUseCRISPR; Donor cassetteExpressionMammalianAvailable sinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits