We narrowed to 15,163 results for: GRN
-
Plasmid#102992PurposeCan be used as backbone for a STAgR reactionDepositorTypeEmpty backboneUseCRISPR; Pcr template for stagr vectorsPromoterU6Available SinceFeb. 6, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pLdCH
Plasmid#84291PurposeExpress gRNA and Cas9 in Leishmania with Hygromycin resistanceDepositorInsertgRNA and Cas9
UseCRISPR; LeishmaniaPromoterL. donovani ribosome RNA promoterAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
Jacquere (all-in-one vector) (Lentiviral Prep)
Viral Prep#247027-LVPurposeReady-to-use Lentiviral Prep particles produced from Jacquere (all-in-one vector) (#247027). In addition to the viral particles, you will also receive purified Jacquere (all-in-one vector) plasmid DNA.DepositorAvailable SinceMay 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
pROS10
Plasmid#107924PurposeURA3 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pU6_(GLuc)_INT[Spinach2]
Plasmid#68430PurposeTransient expression in mammalian cells of an "INT" construct_bearing the "Spinach2" aptamer, targeting the GLuc reporter. U6 promoterDepositorInsertINT construct_bearing the "Spinach2" aptamer
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhuman U6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRainbow-DONOR1
Plasmid#75398PurposeCRISPRainbow-DONOR1DepositorInsertCm(R)-CcdB
UseCRISPRTagsnoPromoterBacteriaAvailable SinceMay 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-Clta KI
Plasmid#131483PurposeEndogenous tagging of Clathrin light chain α: N-terminal (amino acid position: M1)DepositorAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
sgPBRM1-2- LentiCRISPRv2
Plasmid#107404PurposeLentiviral expression of Cas9 and gRNA targeting PBRM1DepositorInsertgRNA targeting PBRM1 (PBRM1 Human)
UseLentiviralAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLC-BFP-FADD
Plasmid#75166PurposeLentiCRISPR-BFP with sgRNA targeting human FADDDepositorAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Shank1-GFP KI
Plasmid#131500PurposeEndogenous tagging of Shank1: C-terminal (amino acid position: STOP codon)DepositorAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
p{CFD4-3xP3::DsRed}
Plasmid#86864PurposeExpresses DsRed in eyes and provides a backbone for expressing two gRNAs. With attB integration site.DepositorTypeEmpty backboneExpressionInsectAvailable SinceApril 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
Intron-Tagging-pX330-Cas9-Blast
Plasmid#159741PurposeExpresses Cas9-2A-Blast and a sgRNA excising EGFP flanked by a splice acceptor and a splice donor from the Intron-Tagging-EGFP-Donor plasmid.DepositorInsertdonor plasmid targeting sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
The Expanded EasyClone-MarkerFree toolkit
Plasmid Kit#1000000190PurposeExpansion of the EasyClone-MarkerFree Vector Set (#1000000098) with eight additional chromosomal loci for the stable integration of heterologous DNA into Saccharomyces cerevisiae by CRISPR/Cas9.DepositorApplicationCloning and Synthetic BiologyVector TypeYeast ExpressionCloning TypeUSERAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRyl_MFE1
Plasmid#84612PurposeIntroduces DSB at MFE1 locus in Y. lipolyticaDepositorInsertCas9
UseCRISPR and Synthetic BiologyExpressionYeastPromoterUAS1B8-TEF(136)Available SinceNov. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCAT005
Plasmid#171632Purpose2nd generation lentiviral transfer plasmid encoding a U6 promoter expressing a spyCas9 sgRNA targeting B2M and an EF1-a promoter expressing mNeonGreenDepositorInsertsspyCas9 sgRNA-B2M
mNeon
UseCRISPR and LentiviralExpressionMammalianPromoterEF1-a and U6Available SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-G3BP1-CDS
Plasmid#136039PurposeG3BP1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (CGGGAATTTGTGAGACAGTAT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
TRMPVneo.Yap.3093
Plasmid#59915PurposeTet on shRNA for conditional Yap1 knockdownDepositorInsertYap1 (Yap1 Mouse)
UseRetroviralAvailable SinceSept. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_26H
Plasmid#91150PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: ZmUbi:Csy4-P2A-TaCas9 + PvUbi1:gRNAs with Csy4 spacers, Plant Selection: PvUbi2:barDepositorInsertEngineering Reagent: ZmUbi:Csy4-P2A-TaCas9 + PvUbi1:gRNAs with Csy4 spacers
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
p5189 pSUPER-shRNA-GFP
Plasmid#24747PurposeAddgene QC next-generation sequencing identified retroviral plasmid backbone elements.DepositorInsertshRNA-GFP
UseRetroviralAvailable SinceJune 2, 2010AvailabilityAcademic Institutions and Nonprofits only -
AOI-WT-Cas9-sg-mouse Ezh2-E10-GFP
Plasmid#91879PurposeExpresses 3xFLAG-Cas9 and a gRNA targeting mouse Ezh2DepositorAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only