We narrowed to 4,733 results for: Gca
-
Plasmid#73284PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site X-2DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
T-STOP sgRNA-1
Plasmid#83346PurposeThe sgRNA at the stop codon of human Brachyury(T) locusDepositorInsertT-STOP sgRNA
ExpressionMammalianPromoterU6Available SinceOct. 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
Antibody#196562-rAbPurposeAnti-6xHis chimeric recombinant antibody. The hybridoma-derived heavy chain variable sequence and kappa light chain are fused to a rabbit IgG Fc.DepositorRecommended ApplicationsWestern BlotReactivitySyntheticSource SpeciesRabbitIsotypeIgGTrial SizeAvailable to purchaseAvailable SinceFeb. 24, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits
-
LentiCRISPR-sgUBA5
Plasmid#86132PurposeLentiviral vector expressing Cas9 and an sgRNA targeting UBA5DepositorAvailable SinceMay 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-delta133HtrA-EGFP
Plasmid#14124DepositorInsertHtrA2 (HTRA2 Human)
TagsEGFPExpressionMammalianMutationDeletion of the first 133 amino-acidsAvailable SinceMarch 7, 2007AvailabilityAcademic Institutions and Nonprofits only -
pTet-GLI2shR
Plasmid#136691PurposeInducible Gli2 shRNA lentiviral plasmid (target sequence: human GLI2 5′CCGGCCTGGCATGACTACCACTATGCTCGAGCATAGTGGTAGTCATGCCAGGTTTTTG 3′)DepositorInsertshRNA_humanGli2 (GLI2 Human)
UseLentiviralAvailable SinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HtrA2-FLAG S400D
Plasmid#15940DepositorAvailable SinceNov. 5, 2007AvailabilityAcademic Institutions and Nonprofits only -
mGFP-hNET-R121A/K334A/R440A
Plasmid#193366Purposeexpression of mutated human norpinephrine transporter tagged with monomeric GFP at the N-terminus in mammalian cellsDepositorInserthuman Norepinephrine Transporter (SLC6A2 Human)
Tagsmonomeric GFP (mGFP)ExpressionMammalianMutationR121A (CGG to GCG) K334A (AAA to GCA) R440A (CGA …PromoterCMVAvailable SinceJan. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001145598)
Plasmid#80173Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO-shCIAP2-B
Plasmid#44132DepositorInsertCIAP2
UseLentiviral and RNAiAvailable SinceMarch 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-CACNA1E KI
Plasmid#131481PurposeEndogenous tagging of CaV2.3, R: N-terminal (amino acid position: G5)DepositorAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSUPER-DsRed
Plasmid#42053DepositorInsertDsRed shRNA
UseRNAi and RetroviralExpressionMammalianAvailable SinceMarch 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
Tubb3gRNA-mCherry
Plasmid#87111Purposemouse Tubb3 target gRNA expression plasmid with CAGmCherryDepositorInsertMouse Tubb3 gRNA
UseCRISPRPromoterCAGAvailable SinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
ATM gRNA (BRDN0001149518)
Plasmid#77529Purpose3rd generation lentiviral gRNA plasmid targeting human ATMDepositorAvailable SinceJuly 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAV-Syn-H2B-jGCaMP8s-WPRE (AAV Retrograde)
Viral Prep#176749-AAVrgPurposeReady-to-use AAV Retrograde particles produced from AAV-Syn-H2B-jGCaMP8s-WPRE (#176749). In addition to the viral particles, you will also receive purified AAV-Syn-H2B-jGCaMP8s-WPRE plasmid DNA. Syn-driven expression of histone H2B fused to calcium sensor GCaMP8s. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceAug. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSynapsin1-axon-GCaMP6s-P2A-mKate2 (AAV9)
Viral Prep#112004-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSynapsin1-axon-GCaMP6s-P2A-mKate2 (#112004). In addition to the viral particles, you will also receive purified pAAV-hSynapsin1-axon-GCaMP6s-P2A-mKate2 plasmid DNA. Synapsin-driven, axon-targeted GCaMP6s calcium sensor and bicistronic mKate2 expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmKate2Available SinceFeb. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL-p21UTRm1
Plasmid#20878DepositorInsertp21 3'UTR site 1 mutation (Cdkn1a Mouse)
UseLuciferaseExpressionMammalianMutationPredicted miRNA binding site 1 (Position ~420) GC…Available SinceAug. 5, 2009AvailabilityAcademic Institutions and Nonprofits only -
pSMP-SUZ12_2
Plasmid#36391DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Gria3-GFP KI
Plasmid#131491PurposeEndogenous tagging of GluA3: C-terminal (amino acid position: STOP codon)DepositorAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-sh-mFAK B
Plasmid#37018DepositorAvailable SinceMay 31, 2012AvailabilityAcademic Institutions and Nonprofits only -
shYES1 # 2
Plasmid#42547DepositorAvailable SinceFeb. 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSMP-DNMT1_1
Plasmid#36382DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-TUBA1B
Plasmid#207763PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the N-terminus of TUBA1B for knock-in.DepositorInsertsgRNA Targeting N-terminus of TUBA1B (TUBA1B Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUDP012
Plasmid#101167PurposeE. coli/S. cerevisiae shuttle vector carrying amdS andSpcas9D147Y P411T and expressing a ribozyme flanked g-RNA for Cas9 editing targeting the gene SeILV6 and in S. pastorianus (HH-gRNASeILV6-HDV)DepositorInsertHH-gRNA-HDV targetting SeILV6 in S. pastorianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-COSMC-KO
Plasmid#80008PurposegRNA to knock out expression of COSMC (C1GalT1C1) gene. The product of this gene is a chaperone aiding in synthesis of Core1 structures on O-linked glycans.DepositorInsertCOSMC (C1GALT1C1 Human)
UseCRISPRAvailable SinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pOsU3-esgRNA
Plasmid#115629Purposeexpression esgRNA in rice protoplastsDepositorInsertOsU3p-esgRNA
UseCRISPRAvailable SinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTR/U6 HDAC4 shRNA
Plasmid#32220DepositorAvailable SinceSept. 16, 2011AvailabilityAcademic Institutions and Nonprofits only -
pWT055e
Plasmid#96866PurposesgRNA-EMX1DepositorInsertsgRNA-EMX1
ExpressionMammalianAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
POLR2A-N CRISPR pX330
Plasmid#124495PurposeA CRISPR plasmid for targeting the N-terminus coding region of human POLR2ADepositorInsertPOLR2A targeting CRISPR
UseCRISPRPromoterU6 promoterAvailable SinceApril 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-scramble
Plasmid#62285Purposeexpression of scramble sgRNA from the arabinose-inducible promoterDepositorInsertscramble sgRNA
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only